Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14807
Trapped Gene
Hnrnpu (ENSMUSG00000039630)
Vector Insertion
Chr 1: 180264017 - 180266087
Public Clones (sanger) D035B10 (ggtc) PST9987-NR (escells) PST8209-NR (escells) PST2621-NR (escells)
PST14648-NR (escells) PST10006-NR (escells) PST9012-NR (escells) PST79-1 (escells)
PST12275-NR (escells) PST1593-NR (escells) PST3815-NR (escells) PST10355-NR (escells)
PST8029-NR (escells) PST5281-NR (escells) PST13301-NR (escells) PST10817-NR (escells)
PST6518-NR (escells) PST12130-NR (escells) PST8444-NR (escells) PST2299-NR (escells)
PST11264-NR (escells) PST2804-NL (escells) PST3915-NR (escells) PST12445-NR (escells)
PST251-1 (escells) PST2423-NR (escells) PSTVU01B3 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320763 (Chr1:180266013..180266086 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAGCCACCTGTTGAAGAAG Chr1:180266055..180266074 59.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320763 (Chr1:180266013..180266086 -)
Downstram Exon
ENSMUSE00000320756 (Chr1:180264018..180264157 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAGCCACCTGTTGAAGAAG Chr1:180266055..180266074 59.01 50 TGCCTTTTGACACACCGTAG Chr1:180264016..180264035 59.76 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000591904 Chr1:180267084..180267915 GGCCCTCAACATGAGTTCTT Chr1:180267693..180267712 59.14 50
upstream ENSMUSE00000320768 Chr1:180266178..180266289 CGTTAAAAGACCGCGAGAAG Chr1:180266227..180266246 60.01 50
upstream ENSMUSE00000320763 Chr1:180266013..180266086 TCAGCCACCTGTTGAAGAAG Chr1:180266055..180266074 59.01 50
upstream ENSMUSE00000320756 Chr1:180264018..180264157 CGAGAGACCGTCTGAGTGCT Chr1:180264111..180264130 60.76 60

*** Putative Vector Insertion (Chr 1: 180264017 - 180266087) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320749 Chr1:180263678..180263777 AGCCAATCCGAACTTCATGT Chr1:180263686..180263705 59.56 45
downstream ENSMUSE00000320744 Chr1:180263128..180263240 No primer for this exon
downstream ENSMUSE00000320736 Chr1:180262224..180262487 CAACTGCACAGTTATGGCAGA Chr1:180262330..180262350 59.92 47.62
downstream ENSMUSE00000320726 Chr1:180261966..180262085 CCCAGGTAGTTTTTCCAGCTC Chr1:180262018..180262038 60.12 52.38
downstream ENSMUSE00000320719 Chr1:180261480..180261608 CTTCTTACGGGCAGCAATTT Chr1:180261479..180261498 59.36 45
downstream ENSMUSE00000320707 Chr1:180261224..180261392 TTTGGGCACACTACAACAGC Chr1:180261288..180261307 59.76 50
downstream ENSMUSE00000320702 Chr1:180260723..180260977 GCCACCACCTCTGTTGAACT Chr1:180260753..180260772 60.16 55
downstream ENSMUSE00000320695 Chr1:180260296..180260477 TAGCCAATTCCACCACTTCC Chr1:180260374..180260393 59.93 50
downstream ENSMUSE00000320688 Chr1:180259999..180260070 GCCACGATTATTTCCTCGTC Chr1:180260019..180260038 59.53 50
downstream ENSMUSE00000591898 Chr1:180258431..180259538 TGCACAATGCTGAGGTTCTC Chr1:180259241..180259260 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGAACACTTCGATCGTGA Chr1:180266031..180266051 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039630