Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14812
Trapped Gene
Upf3b (ENSMUSG00000036572)
Vector Insertion
Chr X: 34640087 - 34642133
Public Clones PST12136-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315790 (ChrX:34642022..34642132 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCTGGAGGAAATTGAAGC ChrX:34642042..34642061 60.33 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315790 (ChrX:34642022..34642132 -)
Downstram Exon
ENSMUSE00000315785 (ChrX:34640088..34640131 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCTGGAGGAAATTGAAGC ChrX:34642042..34642061 60.33 45 AAGGGGCGTTGTCCTTTTAG ChrX:34640090..34640109 60.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714894 ChrX:34650071..34650317 ACGAGTGACCCTGTTTACGC ChrX:34650172..34650191 60.18 55
upstream ENSMUSE00000716801 ChrX:34650071..34650317 ACGAGTGACCCTGTTTACGC ChrX:34650172..34650191 60.18 55
upstream ENSMUSE00000315810 ChrX:34649143..34649249 ACCTATGCCTGAGCACGATT ChrX:34649171..34649190 59.72 50
upstream ENSMUSE00000702089 ChrX:34649143..34649249 ACCTATGCCTGAGCACGATT ChrX:34649171..34649190 59.72 50
upstream ENSMUSE00000702096 ChrX:34648948..34649016 No primer for this exon
upstream ENSMUSE00000503226 ChrX:34648910..34649016 ATTCAGGGACCGATTTGATG ChrX:34648934..34648953 59.75 45
upstream ENSMUSE00000702087 ChrX:34648910..34649016 ATTCAGGGACCGATTTGATG ChrX:34648934..34648953 59.75 45
upstream ENSMUSE00000315796 ChrX:34644424..34644522 TTTGCACCATTTCAAAAAGC ChrX:34644477..34644496 58.79 35
upstream ENSMUSE00000315790 ChrX:34642022..34642132 TTGCTGGAGGAAATTGAAGC ChrX:34642042..34642061 60.33 45
upstream ENSMUSE00000315785 ChrX:34640088..34640131 GAGCTTCCTGAAGAACAAGCA ChrX:34640089..34640109 59.75 47.62

*** Putative Vector Insertion (Chr X: 34640087 - 34642133) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624305 ChrX:34639502..34639684 TTTCCCGTCTCCTCCTTTCT ChrX:34639620..34639639 60.18 50
downstream ENSMUSE00000702085 ChrX:34639061..34639099 No primer for this exon
downstream ENSMUSE00000624304 ChrX:34636853..34637013 AACGCCTGGGCAGAGTATAA ChrX:34636865..34636884 59.73 50
downstream ENSMUSE00000702092 ChrX:34635517..34635781 ATCATGCGCTCCTGATCTCT ChrX:34635724..34635743 59.94 50
downstream ENSMUSE00000708212 ChrX:34635517..34635817 ATCATGCGCTCCTGATCTCT ChrX:34635724..34635743 59.94 50
downstream ENSMUSE00000719003 ChrX:34635517..34635817 ATCATGCGCTCCTGATCTCT ChrX:34635724..34635743 59.94 50
downstream ENSMUSE00000315883 ChrX:34631829..34632656 TTTGTCCACTGGGGAATCTC ChrX:34632533..34632552 59.9 50
downstream ENSMUSE00000702082 ChrX:34631829..34632656 TTTGTCCACTGGGGAATCTC ChrX:34632533..34632552 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGAATAATCGCCTTGCAG ChrX:34642068..34642088 59.02 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCACAGACAATGAGAACG ChrX:34642080..34642100 60.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036572