Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14823
Trapped Gene
Skil (ENSMUSG00000027660)
Vector Insertion
Chr 3: 30996113 - 30996191
Public Clones PST9218-NL (escells) PST21381-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714563 (Chr3:30995625..30996112 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714563 (Chr3:30995625..30996112 +)
Downstram Exon
ENSMUSE00000708811 (Chr3:30996192..30996387 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55 GCAACTGGCATGTTGTTCTC Chr3:30996224..30996243 59.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720909 Chr3:30993980..30994079 AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55
upstream ENSMUSE00000676089 Chr3:30993983..30994079 AGAGGCTGTGTGTAGCGATG Chr3:30993986..30994005 59.06 55
upstream ENSMUSE00000710533 Chr3:30994047..30994079 No primer for this exon
upstream ENSMUSE00000365462 Chr3:30995625..30997341 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000714563 Chr3:30995625..30996112 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000719433 Chr3:30995625..30997341 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55
upstream ENSMUSE00000708585 Chr3:30995755..30997341 AGGGACGATACCTGCCTCTT Chr3:30995765..30995784 60.1 55

*** Putative Vector Insertion (Chr 3: 30996113 - 30996191) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000708811 Chr3:30996192..30996387 GCAACTGGCATGTTGTTCTC Chr3:30996224..30996243 59.3 50
downstream ENSMUSE00000715640 Chr3:30996628..30997341 GAGTCTTTGTGCATCGGTCA Chr3:30996933..30996952 59.84 50
downstream ENSMUSE00000171865 Chr3:31010547..31010644 CCATTCCCGATGGTGTATCT Chr3:31010571..31010590 59.63 50
downstream ENSMUSE00000171866 Chr3:31012330..31012562 AGATGTGAGCGACACATTCG Chr3:31012387..31012406 59.86 50
downstream ENSMUSE00000719075 Chr3:31012330..31012424 AGATGTGAGCGACACATTCG Chr3:31012387..31012406 59.86 50
downstream ENSMUSE00000171863 Chr3:31015738..31015961 CATGATCTTCCCCTTGTCGT Chr3:31015886..31015905 59.93 50
downstream ENSMUSE00000171864 Chr3:31016295..31016519 TCCTTCATCGCCTTTGAACT Chr3:31016335..31016354 59.81 45
downstream ENSMUSE00000335516 Chr3:31017377..31021499 AAGCCAACCTTACGAGAGCA Chr3:31019636..31019655 60.01 50
downstream ENSMUSE00000717340 Chr3:31017377..31017913 TCAAAGCAAGCGACAAACAC Chr3:31017599..31017618 60.03 45
downstream ENSMUSE00000718136 Chr3:31017377..31018202 TCAAAGCAAGCGACAAACAC Chr3:31017599..31017618 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr3:30996161..30996181 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTCGTGACTGGGAAAACC Chr3:30996160..30996180 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027660