Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14827
Trapped Gene
Rps27a (ENSMUSG00000020460)
Vector Insertion
Chr 11: 29447680 - 29447862
Public Clones PST7737-NL (escells) IST14786B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662791 (Chr11:29447841..29447861 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662791 (Chr11:29447841..29447861 -)
Downstram Exon
ENSMUSE00000662788 (Chr11:29447681..29447860 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662791 Chr11:29447841..29447861 No primer for this exon
upstream ENSMUSE00000662788 Chr11:29447681..29447860 No primer for this exon
upstream ENSMUSE00000662790 Chr11:29447681..29447745 No primer for this exon

*** Putative Vector Insertion (Chr 11: 29447680 - 29447862) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000104962 Chr11:29447206..29447260 No primer for this exon
downstream ENSMUSE00000104963 Chr11:29446703..29446788 No primer for this exon
downstream ENSMUSE00000483002 Chr11:29446291..29446422 No primer for this exon
downstream ENSMUSE00000706131 Chr11:29445847..29446029 No primer for this exon
downstream ENSMUSE00000706132 Chr11:29445846..29446029 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTCGTGACTGGGAAAAC Chr11:29447796..29447816 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020460