Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1483
Trapped Gene
Amt (ENSMUSG00000032607)
Vector Insertion
Chr 9: 108201231 - 108201710
Public Clones CD0241 (sanger) G052D05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221519 (Chr9:108201099..108201230 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTCTGAGGGGCACCTGTA Chr9:108201162..108201181 59.72 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221519 (Chr9:108201099..108201230 +)
Downstram Exon
ENSMUSE00000221518 (Chr9:108201711..108201789 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTCTGAGGGGCACCTGTA Chr9:108201162..108201181 59.72 55 GCAGAGCTAACAGGGCATTC Chr9:108201789..108201808 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221513 Chr9:108199253..108199356 GCATCGGATAGTCAGTGTGG Chr9:108199269..108199288 59.12 55
upstream ENSMUSE00000221520 Chr9:108199459..108199626 CCACCTAGCTCATGGAGGAA Chr9:108199491..108199510 60.21 55
upstream ENSMUSE00000221515 Chr9:108200043..108200123 GTTGGAGACATTGCGGAACT Chr9:108200091..108200110 60.12 50
upstream ENSMUSE00000221519 Chr9:108201099..108201230 ACTTCTGAGGGGCACCTGTA Chr9:108201162..108201181 59.72 55

*** Putative Vector Insertion (Chr 9: 108201231 - 108201710) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221518 Chr9:108201711..108201789 GCAGAGCTAACAGGGCATTC Chr9:108201789..108201808 59.99 55
downstream ENSMUSE00000221510 Chr9:108202076..108202221 GTCACACGACAGCCAGACAC Chr9:108202190..108202209 60.38 60
downstream ENSMUSE00000221509 Chr9:108202865..108203045 CTGCTAGTCCTGCCAGCTTT Chr9:108202949..108202968 59.78 55
downstream ENSMUSE00000221522 Chr9:108203404..108203559 ATATCAGCCCCACACGTCTC Chr9:108203502..108203521 59.96 55
downstream ENSMUSE00000386695 Chr9:108203651..108203928 ACATAACCCATCGCCACATT Chr9:108203714..108203733 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATGCAGGTACTGCTGCTG Chr9:108201224..108201244 61.19 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACAAGGACTTGGCTCTCA Chr9:108201207..108201227 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032607