Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14831
Trapped Gene
Ubtf (ENSMUSG00000020923)
Vector Insertion
Chr 11: 102176177 - 102177788
Public Clones (sanger) E059A04 (ggtc) M122B04 (ggtc) M122B04 (ggtc) PST11838-NR (escells)
PST8531-NL (escells) PST8475-NR (escells) PST5206-NR (escells) PST4871-NL (escells)
PST351-2 (escells) PST10125-NR (escells) PST8065-NR (escells) PST4871-NR (escells)
PST4595-NL (escells) PST12504-NR (escells) PST410-1 (escells) PST11371-NR (escells)
PST2772-NR (escells) PST8475-NL (escells) PST697-1 (escells) PST1447-1 (escells)
IST10831H9 (tigm)
Private Clones OST347437 (lexicon) OST282831 (lexicon) OST137883 (lexicon) OST99694 (lexicon)
OST43616 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000447127 (Chr11:102177663..102177787 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000447127 (Chr11:102177663..102177787 -)
Downstram Exon
ENSMUSE00000381120 (Chr11:102176178..102176353 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471236 Chr11:102180162..102180410 No primer for this exon
upstream ENSMUSE00000672162 Chr11:102178896..102179009 No primer for this exon
upstream ENSMUSE00000642574 Chr11:102178488..102178601 No primer for this exon
upstream ENSMUSE00000447127 Chr11:102177663..102177787 No primer for this exon
upstream ENSMUSE00000672160 Chr11:102177663..102178018 No primer for this exon
upstream ENSMUSE00000672164 Chr11:102177663..102177994 No primer for this exon
upstream ENSMUSE00000714466 Chr11:102177663..102177787 No primer for this exon
upstream ENSMUSE00000381120 Chr11:102176178..102176353 No primer for this exon

*** Putative Vector Insertion (Chr 11: 102176177 - 102177788) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000113197 Chr11:102175453..102175536 No primer for this exon
downstream ENSMUSE00000113198 Chr11:102175212..102175367 No primer for this exon
downstream ENSMUSE00000113211 Chr11:102173068..102173132 No primer for this exon
downstream ENSMUSE00000113192 Chr11:102172694..102172814 No primer for this exon
downstream ENSMUSE00000113206 Chr11:102172240..102172350 No primer for this exon
downstream ENSMUSE00000113202 Chr11:102171757..102171890 No primer for this exon
downstream ENSMUSE00000113200 Chr11:102171505..102171646 No primer for this exon
downstream ENSMUSE00000113203 Chr11:102171182..102171223 No primer for this exon
downstream ENSMUSE00000113194 Chr11:102170968..102171081 No primer for this exon
downstream ENSMUSE00000113190 Chr11:102170711..102170866 No primer for this exon
downstream ENSMUSE00000236179 Chr11:102170208..102170363 No primer for this exon
downstream ENSMUSE00000236170 Chr11:102170013..102170123 No primer for this exon
downstream ENSMUSE00000236164 Chr11:102169543..102169631 No primer for this exon
downstream ENSMUSE00000113204 Chr11:102169263..102169452 No primer for this exon
downstream ENSMUSE00000113201 Chr11:102168558..102168605 No primer for this exon
downstream ENSMUSE00000488546 Chr11:102168397..102168464 No primer for this exon
downstream ENSMUSE00000113191 Chr11:102168393..102168464 No primer for this exon
downstream ENSMUSE00000576630 Chr11:102168170..102168313 No primer for this exon
downstream ENSMUSE00000576636 Chr11:102168170..102168313 No primer for this exon
downstream ENSMUSE00000576627 Chr11:102167238..102168080 No primer for this exon
downstream ENSMUSE00000576634 Chr11:102167238..102168080 No primer for this exon
downstream ENSMUSE00000672165 Chr11:102165875..102168080 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr11:102177718..102177738 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCCTTAAGTGGGTTTGG Chr11:102177800..102177820 60.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCCCAGCTTCTCTTTTCAA Chr11:102177634..102177654 59.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCCCAGCTTCTCTTTTCAA Chr11:102177634..102177654 59.93 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020923