Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14843
Trapped Gene
Zfp428 (ENSMUSG00000064264)
Vector Insertion
Chr 7: 25295773 - 25300055
Public Clones PST8062-NR (escells) PST6159-NL (escells) PST4020-NR (escells) PST6159-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000536074 (Chr7:25295752..25295772 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000536074 (Chr7:25295752..25295772 +)
Downstram Exon
ENSMUSE00000536073 (Chr7:25300056..25300124 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGTCGGGCTCTGAAAGAGTG Chr7:25300106..25300125 59.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000465219 Chr7:25292149..25292455 GCGCGATTCTTAAAGCTTCTT Chr7:25292159..25292179 60.13 42.86
upstream ENSMUSE00000466971 Chr7:25295565..25295772 ATGACAGAGACCCGTGAACC Chr7:25295697..25295716 59.97 55
upstream ENSMUSE00000536074 Chr7:25295752..25295772 No primer for this exon

*** Putative Vector Insertion (Chr 7: 25295773 - 25300055) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000536073 Chr7:25300056..25300124 AGTCGGGCTCTGAAAGAGTG Chr7:25300106..25300125 59.6 55
downstream ENSMUSE00000471624 Chr7:25300095..25300549 TATTCGGGGTCATCAGTGGT Chr7:25300158..25300177 60.19 50
downstream ENSMUSE00000536072 Chr7:25300127..25300549 TATTCGGGGTCATCAGTGGT Chr7:25300158..25300177 60.19 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCATCCTGGGGTTAATCG Chr7:25295810..25295830 60.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAAGACCTTTCCCCAGGT Chr7:25298756..25298776 59.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064264