Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14847
Trapped Gene
E2f4 (ENSMUSG00000014859)
Vector Insertion
Chr 8: 107825366 - 107828084
Public Clones PST3223-NR (escells) PST4495-NL (escells) PST3223-NL (escells) PST8795-NL (escells)
PST9887-NR (escells) PST7514-NR (escells) PSTVU01.HL23 (vanderbilt) PSTVU01.F26 (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361381 (Chr8:107825153..107825365 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361381 (Chr8:107825153..107825365 +)
Downstram Exon
ENSMUSE00000235286 (Chr8:107828085..107828132 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336331 Chr8:107821617..107821775 No primer for this exon
upstream ENSMUSE00000214314 Chr8:107822181..107822290 No primer for this exon
upstream ENSMUSE00000214319 Chr8:107822435..107822596 No primer for this exon
upstream ENSMUSE00000214320 Chr8:107822896..107822939 No primer for this exon
upstream ENSMUSE00000214318 Chr8:107823958..107824019 No primer for this exon
upstream ENSMUSE00000214316 Chr8:107824219..107824516 No primer for this exon
upstream ENSMUSE00000361381 Chr8:107825153..107825365 No primer for this exon

*** Putative Vector Insertion (Chr 8: 107825366 - 107828084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235286 Chr8:107828085..107828132 No primer for this exon
downstream ENSMUSE00000235261 Chr8:107828333..107828377 No primer for this exon
downstream ENSMUSE00000459478 Chr8:107828473..107829267 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGCCGTGACTGGGAAAAC Chr8:107825412..107825432 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014859