Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14854
Trapped Gene
9430076C15Rik (ENSMUSG00000053007)
Vector Insertion
Chr 6: 53397713 - 53523367
Public Clones PST4896-NR (escells) PST4896-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000654706 (Chr6:53397540..53397712 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCCAGCTCGGTCATCACT Chr6:53397664..53397683 59.87 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000654706 (Chr6:53397540..53397712 +)
Downstram Exon
ENSMUSE00000616919 (Chr6:53523368..53523432 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCCAGCTCGGTCATCACT Chr6:53397664..53397683 59.87 55 ATGGACATCACTGAGGCTGA Chr6:53523432..53523451 59.21 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699212 Chr6:53237289..53237367 TCTTTGCTCAGTCCAACGTG Chr6:53237303..53237322 60.03 50
upstream ENSMUSE00000444319 Chr6:53237312..53237367 TCTTGCCTTCTCCACACTTG Chr6:53237344..53237363 59.01 50
upstream ENSMUSE00000654707 Chr6:53319778..53319852 TGAACTTGGAGCAGGAGAGG Chr6:53319800..53319819 60.52 55
upstream ENSMUSE00000339301 Chr6:53319781..53319852 TGAACTTGGAGCAGGAGAGG Chr6:53319800..53319819 60.52 55
upstream ENSMUSE00000274476 Chr6:53325933..53326026 TAGGCACAAGCACGAGATGA Chr6:53325965..53325984 60.56 50
upstream ENSMUSE00000410380 Chr6:53338779..53338900 ACGAGTTCAGGAAGGCTCAA Chr6:53338860..53338879 59.99 50
upstream ENSMUSE00000654708 Chr6:53344434..53344505 GGAGGAAACACCCTTTGACA Chr6:53344442..53344461 59.94 50
upstream ENSMUSE00000654706 Chr6:53397540..53397712 AGTCCAGCTCGGTCATCACT Chr6:53397664..53397683 59.87 55

*** Putative Vector Insertion (Chr 6: 53397713 - 53523367) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000616919 Chr6:53523368..53523432 ATGGACATCACTGAGGCTGA Chr6:53523432..53523451 59.21 50
downstream ENSMUSE00000274312 Chr6:53554456..53554582 GCATCAAGACGGCAGAAGAT Chr6:53554583..53554602 60.37 50
downstream ENSMUSE00000274235 Chr6:53560416..53560526 CTGAGGTTTGGACCTTGCAT Chr6:53560477..53560496 60.11 50
downstream ENSMUSE00000699213 Chr6:53595290..53599000 TCCGGAGTCTCTGCAAAAGT Chr6:53598825..53598844 59.99 50
downstream ENSMUSE00000388387 Chr6:53630930..53631253 TCTCCATCATGTGTCCGATG Chr6:53631011..53631030 60.5 50
downstream ENSMUSE00000274307 Chr6:53635287..53635514 AAATTTCCTCCGCCTCTCAT Chr6:53635406..53635425 60.04 45
downstream ENSMUSE00000274302 Chr6:53642893..53643001 GCCACCTCGTTTTTCAACAT Chr6:53642927..53642946 59.98 45
downstream ENSMUSE00000381090 Chr6:53643918..53645827 TTGGACATCTGCGCAAGTAG Chr6:53644698..53644717 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAAGTCTTTGGGGGCCAGAC Chr6:53460688..53460708 61.37 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAAGTCTTTGGGGGCCAGAC Chr6:53460688..53460708 61.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053007