Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14855
Trapped Gene
Eif1ay (ENSMUSG00000067194)
Vector Insertion
Chr X: 155817744 - 155820619
Public Clones PST4790-NR (escells) PST4321-NL (escells) PST11085-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000543722 (ChrX:155817662..155817743 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000543722 (ChrX:155817662..155817743 +)
Downstram Exon
ENSMUSE00000543712 (ChrX:155820620..155820711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CATCATCCCCAATGTCATCA ChrX:155820697..155820716 60.14 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691842 ChrX:155810179..155810347 No primer for this exon
upstream ENSMUSE00000543737 ChrX:155814313..155814396 CTGAAAAGCGAGAGCTTGTG ChrX:155814358..155814377 58.95 50
upstream ENSMUSE00000543733 ChrX:155815391..155815494 TGGGAAACGGACGATTAGAA ChrX:155815415..155815434 60.44 45
upstream ENSMUSE00000543729 ChrX:155816471..155816521 GTGGGGCTACGAGATTACCA ChrX:155816501..155816520 59.96 55
upstream ENSMUSE00000543722 ChrX:155817662..155817743 No primer for this exon

*** Putative Vector Insertion (Chr X: 155817744 - 155820619) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000543712 ChrX:155820620..155820711 CATCATCCCCAATGTCATCA ChrX:155820697..155820716 60.14 45
downstream ENSMUSE00000691806 ChrX:155823340..155823631 TGGAAGGGGTCAAAGTAGGA ChrX:155823588..155823607 59.52 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGCATGGTAAGGGCTGAGT ChrX:155817737..155817758 60.28 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCATGGTAAGGGCTGAGT ChrX:155817737..155817758 60.28 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067194