Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14859
Trapped Gene
Vps13b (ENSMUSG00000037646)
Vector Insertion
Chr 15: 35308788 - 35347265
Public Clones PST4303-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235026 (Chr15:35308644..35308787 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCCATATCCATGAACTGA Chr15:35308673..35308692 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235026 (Chr15:35308644..35308787 +)
Downstram Exon
ENSMUSE00000235019 (Chr15:35347266..35347386 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCCATATCCATGAACTGA Chr15:35308673..35308692 59.88 45 CAGCAGTGCTACGGTTGGTA Chr15:35347317..35347336 59.93 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418943 Chr15:35301304..35301532 TCTGTGGCGTGTTTACCTTG Chr15:35301324..35301343 59.76 50
upstream ENSMUSE00000235032 Chr15:35301688..35301862 GGACGTGGTTCTCAGCAAAC Chr15:35301814..35301833 60.7 55
upstream ENSMUSE00000235026 Chr15:35308644..35308787 TGGCCATATCCATGAACTGA Chr15:35308673..35308692 59.88 45

*** Putative Vector Insertion (Chr 15: 35308788 - 35347265) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235019 Chr15:35347266..35347386 CAGCAGTGCTACGGTTGGTA Chr15:35347317..35347336 59.93 55
downstream ENSMUSE00000624171 Chr15:35352063..35352230 CCACGGTATAGCATTCAGCA Chr15:35352197..35352216 59.71 50
downstream ENSMUSE00000624170 Chr15:35352871..35353052 TGTAAAATGCAGGCGAGTTC Chr15:35353016..35353035 58.92 45
downstream ENSMUSE00000624169 Chr15:35359865..35360039 AGCAATCCCAAGCTGCATTA Chr15:35359954..35359973 60.74 45
downstream ENSMUSE00000624168 Chr15:35368468..35368733 AGTCCCAAGGTCGTCTTCCT Chr15:35368637..35368656 60.11 55
downstream ENSMUSE00000624167 Chr15:35375325..35375420 TGTTCCCAACACAAAACTTCC Chr15:35375403..35375423 59.86 42.86
downstream ENSMUSE00000624166 Chr15:35375793..35375915 CATGGCTCTGCAACCTACAA Chr15:35375858..35375877 59.86 50
downstream ENSMUSE00000624165 Chr15:35376378..35376515 GCACGGGTACCATTGTTTTC Chr15:35376487..35376506 60.24 50
downstream ENSMUSE00000624164 Chr15:35377440..35377527 AAAACGCACCAAACCTCTGT Chr15:35377488..35377507 59.64 45
downstream ENSMUSE00000624163 Chr15:35378285..35378476 TCCAGACGGCAATCTAGAGG Chr15:35378396..35378415 60.35 55
downstream ENSMUSE00000624162 Chr15:35381853..35382022 CTCCCATGATGACAGGAAGC Chr15:35382020..35382039 60.62 55
downstream ENSMUSE00000371182 Chr15:35384712..35384906 TGGCATTCGTGACGTTACTC Chr15:35384739..35384758 59.72 50
downstream ENSMUSE00000395644 Chr15:35386370..35386494 AGGGGATAATTGGTGCAGGT Chr15:35386448..35386467 60.58 50
downstream ENSMUSE00000483848 Chr15:35401638..35401819 TTGGGAGCTCAAAAATACCC Chr15:35401690..35401709 59.02 45
downstream ENSMUSE00000624161 Chr15:35463051..35463185 AGAGTTGGCAGGGGATTCTT Chr15:35463084..35463103 60.07 50
downstream ENSMUSE00000624160 Chr15:35463942..35464115 CCTGAAGCAAAGGGATCAAC Chr15:35463983..35464002 59.67 50
downstream ENSMUSE00000624159 Chr15:35501815..35501924 TTTGCTCGTTTCTGTGGTTG Chr15:35501911..35501930 59.88 45
downstream ENSMUSE00000624158 Chr15:35506134..35506281 GGCCTGATATGACTGCTGCT Chr15:35506241..35506260 60.39 55
downstream ENSMUSE00000356638 Chr15:35506194..35506281 GGCCTGATATGACTGCTGCT Chr15:35506241..35506260 60.39 55
downstream ENSMUSE00000234924 Chr15:35527150..35527277 TCTTCATGAACACGCAGCAC Chr15:35527204..35527223 61.03 50
downstream ENSMUSE00000624157 Chr15:35527150..35527277 TCTTCATGAACACGCAGCAC Chr15:35527204..35527223 61.03 50
downstream ENSMUSE00000125242 Chr15:35536885..35537119 GGCAGGTTGTCATTTGGAAT Chr15:35536934..35536953 59.8 45
downstream ENSMUSE00000125244 Chr15:35547353..35547573 CATAGGCTCCACAAGGGAAA Chr15:35547447..35547466 60.07 50
downstream ENSMUSE00000125243 Chr15:35553357..35553560 ACCTACGCTGCTCCAAACTG Chr15:35553503..35553522 60.45 55
downstream ENSMUSE00000125249 Chr15:35569608..35569779 CGAATCATCACCAGCTTGAA Chr15:35569640..35569659 59.8 45
downstream ENSMUSE00000125247 Chr15:35570285..35570399 CACATCCTGCACGTCTATGG Chr15:35570346..35570365 60.14 55
downstream ENSMUSE00000234905 Chr15:35572153..35572219 ATGTCCTGACTGCCAACCTT Chr15:35572183..35572202 59.58 50
downstream ENSMUSE00000234901 Chr15:35572601..35572651 No primer for this exon
downstream ENSMUSE00000624156 Chr15:35572814..35572838 CCCCAACACTCTTCTCCAAG Chr15:35572837..35572856 59.69 55
downstream ENSMUSE00000624155 Chr15:35572841..35572867 TACAGGAAAGGAAGGCACCTC Chr15:35572864..35572884 60.62 52.38
downstream ENSMUSE00000624154 Chr15:35572871..35572918 CTAAGGGGTCGAACCAACAA Chr15:35572908..35572927 59.96 50
downstream ENSMUSE00000624153 Chr15:35572922..35572948 AGAAGAAAGGAAGGCAGGACA Chr15:35572950..35572970 60.37 47.62
downstream ENSMUSE00000624152 Chr15:35575728..35576136 GGTTAACTTGTGGCGGACAT Chr15:35575829..35575848 59.86 50
downstream ENSMUSE00000624151 Chr15:35582010..35582121 CGGATTATCAGCCTGAGGAG Chr15:35582089..35582108 59.79 55
downstream ENSMUSE00000624150 Chr15:35598456..35598659 CTGAGCAGTGCCGATATTGA Chr15:35598558..35598577 59.97 50
downstream ENSMUSE00000624149 Chr15:35601054..35601180 TGCTCCAGTTATTCGCACAG Chr15:35601132..35601151 60.01 50
downstream ENSMUSE00000624148 Chr15:35604564..35604707 GTTGATGGCTCCAATCCAGT Chr15:35604697..35604716 59.93 50
downstream ENSMUSE00000624147 Chr15:35638881..35639568 TTGTCTGGCAGATGACCTTG Chr15:35639381..35639400 59.83 50
downstream ENSMUSE00000624146 Chr15:35675402..35675539 CTGCAGCCACACGATGTTAT Chr15:35675457..35675476 59.75 50
downstream ENSMUSE00000624145 Chr15:35700211..35700618 TAGAGTCTGACGGGGTGGAG Chr15:35700357..35700376 60.25 60
downstream ENSMUSE00000624144 Chr15:35721794..35721996 GGAGGAATGATGATCCAAGG Chr15:35721823..35721842 59.29 50
downstream ENSMUSE00000624143 Chr15:35723589..35723793 CTGATTCGGGTACTGGCATT Chr15:35723694..35723713 59.96 50
downstream ENSMUSE00000624142 Chr15:35724060..35724244 CGTGATTCGTACAAGGGTGA Chr15:35724181..35724200 59.57 50
downstream ENSMUSE00000427778 Chr15:35763939..35764135 ACGCAACAAAAACCTTCTGG Chr15:35763993..35764012 60.15 45
downstream ENSMUSE00000234730 Chr15:35769630..35769811 AGATGAGCGAACTGGAAGGA Chr15:35769773..35769792 59.95 50
downstream ENSMUSE00000234721 Chr15:35771004..35771353 TTCACCACAGTTTGCATCGT Chr15:35771208..35771227 60.16 45
downstream ENSMUSE00000234713 Chr15:35776601..35776762 TGGAGACTCGCCAAAAGAAT Chr15:35776725..35776744 59.81 45
downstream ENSMUSE00000234707 Chr15:35799042..35799197 TGAGTGCTCGGACTTTGATG Chr15:35799183..35799202 59.98 50
downstream ENSMUSE00000234701 Chr15:35805317..35805580 CTTGACCAGTCCTCGTCTCC Chr15:35805534..35805553 59.83 60
downstream ENSMUSE00000234693 Chr15:35806135..35806218 TCGCTGCTGAACTTGAGAGT Chr15:35806218..35806237 58.91 50
downstream ENSMUSE00000234684 Chr15:35806397..35806572 TCAGGTTCGACATTTTGCAG Chr15:35806545..35806564 59.84 45
downstream ENSMUSE00000234676 Chr15:35807252..35807422 GATATGGGAACCGCACAATC Chr15:35807293..35807312 60.16 50
downstream ENSMUSE00000234672 Chr15:35808398..35808599 TTGGGCTATCCCACTGACTC Chr15:35808432..35808451 60.07 55
downstream ENSMUSE00000234666 Chr15:35809524..35809712 GGGAAAGCTCCGAGTCTGAT Chr15:35809702..35809721 60.74 55
downstream ENSMUSE00000234659 Chr15:35812644..35812790 ATGACTTGTATGCCGTGCTG Chr15:35812696..35812715 59.75 50
downstream ENSMUSE00000234653 Chr15:35814262..35814545 AGTTCCAAAGGGCACTGCTA Chr15:35814522..35814541 59.88 50
downstream ENSMUSE00000234646 Chr15:35816632..35816759 TACTGGGCATCTGTTGTGGA Chr15:35816734..35816753 60.11 50
downstream ENSMUSE00000234638 Chr15:35816938..35817137 CCACTCGGCTGTCATTTCTT Chr15:35817104..35817123 60.26 50
downstream ENSMUSE00000234631 Chr15:35835027..35835145 TTCCGGGGCTAGAATGATAA Chr15:35835113..35835132 59.5 45
downstream ENSMUSE00000234624 Chr15:35839902..35840704 CAAAGGTGAACTCGCTGACA Chr15:35840338..35840357 60.03 50
downstream ENSMUSE00000234619 Chr15:35844529..35844705 GTGCTTGACGAATGATGTGG Chr15:35844698..35844717 60.12 50
downstream ENSMUSE00000234615 Chr15:35846802..35846972 CGGTTGTAGTGCTCCTCGTC Chr15:35846889..35846908 60.85 60
downstream ENSMUSE00000234608 Chr15:35852942..35853118 TGGTGAATACCCCCATGATT Chr15:35853076..35853095 59.87 45
downstream ENSMUSE00000234602 Chr15:35855059..35855161 TATTTGACGTGGCTGTTTGG Chr15:35855158..35855177 59.58 45
downstream ENSMUSE00000234597 Chr15:35855796..35856045 TTCTGATGTCAGCAGCAAGC Chr15:35855907..35855926 60.3 50
downstream ENSMUSE00000624141 Chr15:35859610..35859849 GTGGGTCCACCAAATAATGG Chr15:35859787..35859806 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGTTGCCTTTGTTTATGA Chr15:35314761..35314782 60.12 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTTTTACGTGACTGGGAAAAC Chr15:35314831..35314854 59.96 43.48 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037646