Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14877
Trapped Gene
Rps27l (ENSMUSG00000036781)
Vector Insertion
Chr 9: 66795505 - 66797135
Public Clones CMHD-GT_527D3-3 (cmhd) CMHD-GT_525D10-3 (cmhd) CMHD-GT_393G5-3 (cmhd) PST6659-NR (escells)
PST12161-NR (escells) PST4656-NR (escells) PST4921-NR (escells) PST4921-NL (escells)
Private Clones OST9120 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240947 (Chr9:66795394..66795504 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTTCAGCCATGCACAGACT Chr9:66795415..66795434 59.44 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240947 (Chr9:66795394..66795504 +)
Downstram Exon
ENSMUSE00000398331 (Chr9:66797136..66797319 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTTCAGCCATGCACAGACT Chr9:66795415..66795434 59.44 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340744 Chr9:66793907..66793987 CTCGAAAGCGAGCAGTTCGT Chr9:66793922..66793941 63.06 55
upstream ENSMUSE00000240972 Chr9:66794638..66794746 GAAGAAACGGCTGGTTCAGA Chr9:66794691..66794710 60.38 50
upstream ENSMUSE00000240947 Chr9:66795394..66795504 TTTTCAGCCATGCACAGACT Chr9:66795415..66795434 59.44 45

*** Putative Vector Insertion (Chr 9: 66795505 - 66797135) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000398331 Chr9:66797136..66797319 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAGGCTCACAGAAGGTA Chr9:66795489..66795509 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCAGGCTCACAGAAGGTA Chr9:66795489..66795509 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036781