Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14888
Trapped Gene
Zfp420 (ENSMUSG00000058402)
Vector Insertion
Chr 7: 30698260 - 30700114
Public Clones PST10800-NR (escells) PST13932-NR (escells) PST3988-NR (escells) PST11810-NR (escells)
PST3117-NR (escells) PST3988-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675968 (Chr7:30698240..30698259 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675968 (Chr7:30698240..30698259 +)
Downstram Exon
ENSMUSE00000487296 (Chr7:30700115..30700678 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAGGCATAAGGCTTCTCAC Chr7:30700240..30700259 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489043 Chr7:30645060..30645112 No primer for this exon
upstream ENSMUSE00000467488 Chr7:30645078..30645112 No primer for this exon
upstream ENSMUSE00000418591 Chr7:30646035..30646087 No primer for this exon
upstream ENSMUSE00000418589 Chr7:30657911..30657952 CAGGGATGTTTAATGATGTTGC Chr7:30657915..30657936 59.34 40.91
upstream ENSMUSE00000460581 Chr7:30659198..30661846 TACCGGTGAGAAACCCTACG Chr7:30660620..30660639 59.99 55
upstream ENSMUSE00000515222 Chr7:30659198..30661519 TACCGGTGAGAAACCCTACG Chr7:30660620..30660639 59.99 55
upstream ENSMUSE00000485035 Chr7:30659511..30659975 GGAAGGCCTTTATTCGAAGC Chr7:30659731..30659750 60.17 50
upstream ENSMUSE00000534709 Chr7:30660060..30660673 TACCGGTGAGAAACCCTACG Chr7:30660620..30660639 59.99 55
upstream ENSMUSE00000635720 Chr7:30660758..30661005 CATCAGCGAACTCACACTGG Chr7:30660774..30660793 60.46 55
upstream ENSMUSE00000675968 Chr7:30698240..30698259 No primer for this exon

*** Putative Vector Insertion (Chr 7: 30698260 - 30700114) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487296 Chr7:30700115..30700678 GCAGGCATAAGGCTTCTCAC Chr7:30700240..30700259 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:30698311..30698331 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000058402