Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14906
Trapped Gene
Ddb1 (ENSMUSG00000024740)
Vector Insertion
Chr 19: 10690081 - 10693538
Public Clones PST14618-NL (escells) PST9261-NR (escells) PST9457-NR (escells) PST9836-NR (escells)
PST14618-NR (escells) PST2709-NR (escells) PST2709-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000144664 (Chr19:10689978..10690080 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCAGCATTGACTTACCAG Chr19:10690052..10690071 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000144664 (Chr19:10689978..10690080 +)
Downstram Exon
ENSMUSE00000144673 (Chr19:10693539..10693614 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCAGCATTGACTTACCAG Chr19:10690052..10690071 59.86 50 CCAAAGTGTCATCCGTCTCC Chr19:10693592..10693611 60.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714375 Chr19:10680058..10680256 CAACCCAAGGCCTCAATATG Chr19:10680179..10680198 60.32 50
upstream ENSMUSE00000714790 Chr19:10680058..10680256 CAACCCAAGGCCTCAATATG Chr19:10680179..10680198 60.32 50
upstream ENSMUSE00000144672 Chr19:10681335..10681483 TCAGCGGAAGATCTGAACCT Chr19:10681346..10681365 59.95 50
upstream ENSMUSE00000694224 Chr19:10681335..10681362 No primer for this exon
upstream ENSMUSE00000144662 Chr19:10682283..10682399 ATAAGCAGAGTGGCGAAAGC Chr19:10682344..10682363 59.62 50
upstream ENSMUSE00000144661 Chr19:10682741..10682962 CGTATGATTGGCCTTCGACT Chr19:10682798..10682817 60.1 50
upstream ENSMUSE00000144657 Chr19:10685192..10685306 CGGCATGTGAAAACCTATGA Chr19:10685204..10685223 59.54 45
upstream ENSMUSE00000144656 Chr19:10686134..10686231 TGGCAATTGCTCCTCCTATC Chr19:10686206..10686225 60.18 50
upstream ENSMUSE00000144655 Chr19:10687363..10687521 AGATATGGAGGGACGGCTTT Chr19:10687422..10687441 59.92 50
upstream ENSMUSE00000144667 Chr19:10688598..10688681 GGTGACTCCCAGCTCGTAAA Chr19:10688661..10688680 60.26 55
upstream ENSMUSE00000144652 Chr19:10689342..10689458 AGCAACGAACAAGGCTCCTA Chr19:10689354..10689373 60.01 50
upstream ENSMUSE00000144664 Chr19:10689978..10690080 TGCCAGCATTGACTTACCAG Chr19:10690052..10690071 59.86 50

*** Putative Vector Insertion (Chr 19: 10690081 - 10693538) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000144673 Chr19:10693539..10693614 CCAAAGTGTCATCCGTCTCC Chr19:10693592..10693611 60.51 55
downstream ENSMUSE00000144666 Chr19:10693710..10693818 TCTGCTGATCGTCCACAAAG Chr19:10693780..10693799 59.98 50
downstream ENSMUSE00000144671 Chr19:10696031..10696209 AGCTTTGGGCTCTTGAGACA Chr19:10696078..10696097 60.13 50
downstream ENSMUSE00000144650 Chr19:10696311..10696474 TATCCAAGCATGCCACTTCA Chr19:10696351..10696370 60.22 45
downstream ENSMUSE00000144675 Chr19:10696552..10696659 TCGATGTTGAGCCCAAAGTA Chr19:10696657..10696676 59.27 45
downstream ENSMUSE00000694223 Chr19:10696590..10696659 TCGATGTTGAGCCCAAAGTA Chr19:10696657..10696676 59.27 45
downstream ENSMUSE00000144663 Chr19:10696780..10696987 AGAGCAAGCAAAGACGTTGG Chr19:10696880..10696899 60.57 50
downstream ENSMUSE00000144660 Chr19:10697829..10697924 AGGGGAACTGTGCGAATATG Chr19:10697912..10697931 59.96 50
downstream ENSMUSE00000144654 Chr19:10698017..10698128 CTGGGCCTCAAAGCAGTAGT Chr19:10698118..10698137 59.5 55
downstream ENSMUSE00000144668 Chr19:10699214..10699337 AGCCGTACTGCTGGAGAAAA Chr19:10699267..10699286 60.01 50
downstream ENSMUSE00000144670 Chr19:10699657..10699821 GACCACAATACGACCCTGCT Chr19:10699808..10699827 60 55
downstream ENSMUSE00000144653 Chr19:10700386..10700480 GCAGCTTCCCATTAAACTCC Chr19:10700463..10700482 58.79 50
downstream ENSMUSE00000144674 Chr19:10701082..10701252 CTCAGTGCGAAGCTCCTTTT Chr19:10701129..10701148 59.76 50
downstream ENSMUSE00000144669 Chr19:10701616..10701725 TCTCCACTGCACTCATCCAG Chr19:10701661..10701680 59.98 55
downstream ENSMUSE00000144659 Chr19:10701979..10702148 TGGAAGAGACCAACCTCCTG Chr19:10702035..10702054 60.23 55
downstream ENSMUSE00000144665 Chr19:10702252..10702354 CTGCATGTCCAACAGGAGGT Chr19:10702307..10702326 61.13 55
downstream ENSMUSE00000144649 Chr19:10702915..10703038 AAGTTTGCCACAACCTCCTG Chr19:10703037..10703056 60.15 50
downstream ENSMUSE00000338049 Chr19:10703569..10704306 GAACCCTCTCGACCCTCTTC Chr19:10704086..10704105 60.19 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGAGTGGCTTTGGCCTTA Chr19:10690114..10690134 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTTGCTGAACGTGACTGG Chr19:10690121..10690141 60.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024740