Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14910
Trapped Gene
Dnaja1 (ENSMUSG00000028410)
Vector Insertion
Chr 4: 40678833 - 40679108
Public Clones (ggtc) PST5816-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000178919 (Chr4:40678717..40678832 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACATACAGCTGGTTGAAGC Chr4:40678744..40678764 59.76 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000178919 (Chr4:40678717..40678832 +)
Downstram Exon
ENSMUSE00000495417 (Chr4:40679109..40679209 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACATACAGCTGGTTGAAGC Chr4:40678744..40678764 59.76 52.38 TATGGCCGACGGTATATTGG Chr4:40679181..40679200 60.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000178927 Chr4:40669566..40669666 No primer for this exon
upstream ENSMUSE00000297668 Chr4:40670736..40670877 CCACCCAGGAAGAATTGAAA Chr4:40670795..40670814 59.9 45
upstream ENSMUSE00000178918 Chr4:40671006..40671183 TGTTCTTTGGAGGAGGAGGA Chr4:40671142..40671161 59.77 50
upstream ENSMUSE00000479344 Chr4:40673138..40673242 TGGTGCAACAAGAAAACTGG Chr4:40673187..40673206 59.73 45
upstream ENSMUSE00000496461 Chr4:40674989..40675216 TCATGGAGAACGCATCAGTC Chr4:40675119..40675138 59.79 50
upstream ENSMUSE00000493612 Chr4:40677206..40677320 AACATTCCACGGTGAAGGAG Chr4:40677228..40677247 59.97 50
upstream ENSMUSE00000178919 Chr4:40678717..40678832 GGACATACAGCTGGTTGAAGC Chr4:40678744..40678764 59.76 52.38

*** Putative Vector Insertion (Chr 4: 40678833 - 40679108) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000495417 Chr4:40679109..40679209 TATGGCCGACGGTATATTGG Chr4:40679181..40679200 60.55 50
downstream ENSMUSE00000178924 Chr4:40679761..40680932 GCAGAAGGGGATGCAATCTA Chr4:40680563..40680582 60.18 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTTTCCCTGCTTTGCATT Chr4:40678853..40678873 60.25 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTTCCCTGCTTTGCATT Chr4:40678853..40678873 60.25 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028410