Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14911
Trapped Gene
Ttc1 (ENSMUSG00000041278)
Vector Insertion
Chr 11: 43543510 - 43549976
Public Clones PST5861-NR (escells) PST5861-NL (escells)
Private Clones OST355874 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679714 (Chr11:43549917..43549975 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679714 (Chr11:43549917..43549975 -)
Downstram Exon
ENSMUSE00000394807 (Chr11:43543511..43544109 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTGTGCGGCTCTAAGAGGT Chr11:43543662..43543681 60.16 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000261891 Chr11:43561424..43561484 GAGAGGAGCTGGGAGGTTGT Chr11:43561453..43561472 60.79 60
upstream ENSMUSE00000679715 Chr11:43561424..43561510 GAGAGGAGCTGGGAGGTTGT Chr11:43561453..43561472 60.79 60
upstream ENSMUSE00000261887 Chr11:43558587..43558949 CATGGTTTCTGATCCCAAGG Chr11:43558805..43558824 60.31 50
upstream ENSMUSE00000720319 Chr11:43558587..43558949 CATGGTTTCTGATCCCAAGG Chr11:43558805..43558824 60.31 50
upstream ENSMUSE00000261882 Chr11:43555263..43555323 AGGGGAATGAGCGGTTTAAG Chr11:43555270..43555289 60.44 50
upstream ENSMUSE00000261873 Chr11:43553219..43553331 AAATAGAGCTGCTGCGAGGA Chr11:43553227..43553246 60.26 50
upstream ENSMUSE00000261867 Chr11:43552299..43552335 No primer for this exon
upstream ENSMUSE00000261860 Chr11:43551369..43551517 TCCGTGCAATACTGAGGAGA Chr11:43551474..43551493 59.39 50
upstream ENSMUSE00000261850 Chr11:43549921..43549975 No primer for this exon
upstream ENSMUSE00000679714 Chr11:43549917..43549975 No primer for this exon
upstream ENSMUSE00000394807 Chr11:43543511..43544109 CCATGCAAGCCTGTAGTTGA Chr11:43543636..43543655 59.86 50

*** Putative Vector Insertion (Chr 11: 43543510 - 43549976) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679713 Chr11:43543014..43544109 GACCTCGATGGAAACCAGAA Chr11:43543393..43543412 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTGGGAGGCCATGAACTGT Chr11:43549930..43549950 61.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 2 CTAGGGTAATCGCCTTGCAG Chr11:43549851..43549871 59.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 AGGAGACTAGGGCGTGACTG Chr11:43549857..43549877 59.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041278