Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14917
Trapped Gene
CT030190.9 (ENSMUSG00000074897)
Vector Insertion
Chr 16: 94792142 - 94833025
Public Clones (sanger) (sanger) (sanger) (sanger) 3SE090B02 (ggtc) 3SP116G11 (ggtc)
5SE066C09 (ggtc) 5SE002H11 (ggtc) PST1101-2 (escells) IST10610D1 (tigm)
IST14609G6 (tigm) IST14996F5 (tigm) IST14221H8 (tigm) IST13207B9 (tigm)
IST14375G1 (tigm) IST14566D2 (tigm) IST14429G11 (tigm) IST14611A2 (tigm)
Private Clones OST177932 (lexicon) OST176909 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641985 (Chr16:94791617..94792141 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAATCCTCGTCGGGAAGAA Chr16:94791783..94791802 60.93 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641985 (Chr16:94791617..94792141 +)
Downstram Exon
ENSMUSE00000697261 (Chr16:94833026..94833085 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAATCCTCGTCGGGAAGAA Chr16:94791783..94791802 60.93 45 AGAGTCCAGCGGCAAAACTA Chr16:94833053..94833072 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641985 Chr16:94791617..94792141 AAAATCCTCGTCGGGAAGAA Chr16:94791783..94791802 60.93 45

*** Putative Vector Insertion (Chr 16: 94792142 - 94833025) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000697261 Chr16:94833026..94833085 AGAGTCCAGCGGCAAAACTA Chr16:94833053..94833072 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAATTTCAGTCCCTGTCCAA Chr16:94795120..94795141 59.96 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr16:94795189..94795209 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074897