Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14919
Trapped Gene
Add1 (ENSMUSG00000029106)
Vector Insertion
Chr 5: 34971822 - 34973118
Public Clones PST843-2 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698960 (Chr5:34971788..34971821 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698960 (Chr5:34971788..34971821 +)
Downstram Exon
ENSMUSE00000698957 (Chr5:34973119..34973465 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GACGGGGTACGGAACTTCTT Chr5:34973431..34973450 60.36 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699018 Chr5:34916461..34916562 GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60
upstream ENSMUSE00000418981 Chr5:34916512..34916562 GTGCTCTCTCCCCGATTCTC Chr5:34916536..34916555 61.28 60
upstream ENSMUSE00000698963 Chr5:34916691..34917273 TGGTTCACCTGAAACTGCTG Chr5:34917186..34917205 59.87 50
upstream ENSMUSE00000698962 Chr5:34938218..34938354 GGTTCTTAGCAGCCTGAGGA Chr5:34938312..34938331 59.57 55
upstream ENSMUSE00000600629 Chr5:34943973..34944187 CCAGAATATTTGCGGGAGAG Chr5:34944089..34944108 59.66 50
upstream ENSMUSE00000708931 Chr5:34943973..34944187 CCAGAATATTTGCGGGAGAG Chr5:34944089..34944108 59.66 50
upstream ENSMUSE00000600643 Chr5:34943991..34944187 CCAGAATATTTGCGGGAGAG Chr5:34944089..34944108 59.66 50
upstream ENSMUSE00000654143 Chr5:34947339..34947501 GCAGCAGATTGCAGATTTCA Chr5:34947416..34947435 60.1 45
upstream ENSMUSE00000654142 Chr5:34948477..34948628 GGCTGGTCCCAGCTTATCTA Chr5:34948596..34948615 59.29 55
upstream ENSMUSE00000654141 Chr5:34952841..34952921 GCAGGAACACTTCCTCATCG Chr5:34952858..34952877 60.8 55
upstream ENSMUSE00000654139 Chr5:34953139..34953288 CTCTGCACTCGGCAGTGTAT Chr5:34953212..34953231 59.06 55
upstream ENSMUSE00000654138 Chr5:34955937..34956080 AGGCACTTTCCCTTGGAGAT Chr5:34955977..34955996 60.07 50
upstream ENSMUSE00000654137 Chr5:34956168..34956266 CGTGGAGGAGGCCTTCTATT Chr5:34956212..34956231 60.59 55
upstream ENSMUSE00000654134 Chr5:34956833..34957009 CTCTTATGCGGATGCTCGAT Chr5:34956984..34957003 60.34 50
upstream ENSMUSE00000654131 Chr5:34959212..34959463 AAGCAGTCCCAAGTCGAAGA Chr5:34959439..34959458 59.99 50
upstream ENSMUSE00000698966 Chr5:34959212..34959556 AAGCAGTCCCAAGTCGAAGA Chr5:34959439..34959458 59.99 50
upstream ENSMUSE00000654126 Chr5:34961999..34962100 CACCTCTGCTGTCCCTAACC Chr5:34962028..34962047 59.72 60
upstream ENSMUSE00000654124 Chr5:34962694..34962783 ATTAAGACGGCAGGACCTCA Chr5:34962718..34962737 59.69 50
upstream ENSMUSE00000698961 Chr5:34963481..34963567 GCTCGCAGAGCAGACCTTTA Chr5:34963519..34963538 60.82 55
upstream ENSMUSE00000654122 Chr5:34967928..34968084 GAATACCGACGAGAGGTGGA Chr5:34968042..34968061 60.07 55
upstream ENSMUSE00000654119 Chr5:34971064..34971162 AGTCAGCTGTCCCCAACACT Chr5:34971112..34971131 59.76 55
upstream ENSMUSE00000348510 Chr5:34971785..34971821 GGAGACGGATGTGCTAAAGAG Chr5:34971787..34971807 58.95 52.38
upstream ENSMUSE00000698960 Chr5:34971788..34971821 No primer for this exon

*** Putative Vector Insertion (Chr 5: 34971822 - 34973118) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000380985 Chr5:34973119..34974954 ACCTCCCCACACAAGTCAAG Chr5:34974341..34974360 60 55
downstream ENSMUSE00000698957 Chr5:34973119..34973465 GACGGGGTACGGAACTTCTT Chr5:34973431..34973450 60.36 55
downstream ENSMUSE00000698959 Chr5:34973119..34974943 ACCTCCCCACACAAGTCAAG Chr5:34974341..34974360 60 55
downstream ENSMUSE00000698968 Chr5:34973119..34974264 ATGGGAGGGGGCTCTAGTTA Chr5:34973602..34973621 59.92 55
downstream ENSMUSE00000698973 Chr5:34973119..34974264 ATGGGAGGGGGCTCTAGTTA Chr5:34973602..34973621 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACAGCAGGAGACGGATGTG Chr5:34971781..34971801 59.85 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACAGCAGGAGACGGATGTG Chr5:34971781..34971801 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029106