Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14923
Trapped Gene
Zfp42 (ENSMUSG00000051176)
Vector Insertion
Chr 8: 44385981 - 44388334
Public Clones E022E05 (ggtc) P115C02 (ggtc) D020C07 (ggtc) H004C05 (ggtc) D016G12 (ggtc)
PST1221 (escells) PST1222-NL (escells) PST23659-NR (escells) PST13692-NR (escells)
IST14197D4 (tigm)
Private Clones OST431440 (lexicon) OST329594 (lexicon) OST303231 (lexicon) OST300237 (lexicon)
OST237298 (lexicon) OST190931 (lexicon) OST43256 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706533 (Chr8:44388229..44388333 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGAGCTGTCCTGGAACT Chr8:44388302..44388321 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706533 (Chr8:44388229..44388333 -)
Downstram Exon
ENSMUSE00000482761 (Chr8:44385982..44386059 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGAGCTGTCCTGGAACT Chr8:44388302..44388321 59.99 55 ATTTGGGGACAACACTTGGA Chr8:44385975..44385994 60.21 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510068 Chr8:44392195..44392290 CTGGGTACGAGTGGCAGTTT Chr8:44392265..44392284 60.17 55
upstream ENSMUSE00000481791 Chr8:44389830..44389913 GGACACGTGGCAAAAGAAGA Chr8:44389875..44389894 61.22 50
upstream ENSMUSE00000706533 Chr8:44388229..44388333 TCCTGAGCTGTCCTGGAACT Chr8:44388302..44388321 59.99 55
upstream ENSMUSE00000482761 Chr8:44385982..44386059 TCCAAGTGTTGTCCCCAAAT Chr8:44385997..44386016 60.21 45

*** Putative Vector Insertion (Chr 8: 44385981 - 44388334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000480945 Chr8:44380422..44381890 CTTTGCGTGGGTTAGGATGT Chr8:44380946..44380965 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:44388263..44388283 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAATCGCCTTGCAGCACAT Chr8:44388158..44388178 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 AGGAGACGTGACTGGGAAAA Chr8:44388163..44388183 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051176