Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14925
Trapped Gene
AC117232.3 (ENSMUSG00000025362)
Vector Insertion
Chr 10: 128063118 - 128063557
Public Clones CMHD-GT_489D6-3 (cmhd) CMHD-GT_506B4-3 (cmhd) CMHD-GT_503A4-3 (cmhd) PST1080-3 (escells)
PST1081-3 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000665415 (Chr10:128063532..128063556 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000665415 (Chr10:128063532..128063556 -)
Downstram Exon
ENSMUSE00000150118 (Chr10:128063119..128063296 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAGCGGCTTCTACAATGTT Chr10:128063132..128063151 60.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665415 Chr10:128063532..128063556 No primer for this exon
upstream ENSMUSE00000150118 Chr10:128063119..128063296 CTGAAGCAAGCGTCTTCGAC Chr10:128063120..128063139 61.26 55

*** Putative Vector Insertion (Chr 10: 128063118 - 128063557) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000150121 Chr10:128062263..128062393 CTCACGCAATAATGCAGCTT Chr10:128062326..128062345 59.09 45
downstream ENSMUSE00000639408 Chr10:128061593..128061692 CCTTCCGTCCTTACAAAACG Chr10:128061609..128061628 59.6 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr10:128063463..128063483 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCAAGATGGTGAGTGTCG Chr10:128063520..128063540 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025362