Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14930
Trapped Gene
Rps10 (ENSMUSG00000052146)
Vector Insertion
Chr 17: 27768144 - 27769302
Public Clones PST304-1 (escells) PST10133-NR (escells) PST2272-NR (escells)
Private Clones OST407658 (lexicon) OST379955 (lexicon) OST357077 (lexicon) OST353115 (lexicon)
OST282404 (lexicon) OST248456 (lexicon) OST248346 (lexicon) OST239068 (lexicon)
OST233860 (lexicon) OST230121 (lexicon) OST213884 (lexicon) OST181467 (lexicon)
OST100226 (lexicon) OST100130 (lexicon) OST43364 (lexicon) OST31307 (lexicon)
OST5941 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139788 (Chr17:27769224..27769301 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTACAGAAGGAGCGCTGT Chr17:27769229..27769248 59.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139788 (Chr17:27769224..27769301 -)
Downstram Exon
ENSMUSE00000700902 (Chr17:27768145..27768200 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTACAGAAGGAGCGCTGT Chr17:27769229..27769248 59.12 55 GCCTCAGCTTTCTTGTCAGC Chr17:27768154..27768173 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700896 Chr17:27773510..27773574 CAGTCCCCCATCAGACAACT Chr17:27773521..27773540 59.96 55
upstream ENSMUSE00000700904 Chr17:27772149..27772221 No primer for this exon
upstream ENSMUSE00000700926 Chr17:27772149..27772185 No primer for this exon
upstream ENSMUSE00000549878 Chr17:27771271..27771420 CGGATTGCCATCTACGAACT Chr17:27771380..27771399 60.1 50
upstream ENSMUSE00000721935 Chr17:27771271..27771420 CGGATTGCCATCTACGAACT Chr17:27771380..27771399 60.1 50
upstream ENSMUSE00000139792 Chr17:27771017..27771188 CTCCGAGACTACCTGCACCT Chr17:27771085..27771104 59.47 60
upstream ENSMUSE00000139788 Chr17:27769224..27769301 ACCTACAGAAGGAGCGCTGT Chr17:27769229..27769248 59.12 55
upstream ENSMUSE00000700902 Chr17:27768145..27768200 GCTCAGCCACTGAGTTCCAG Chr17:27768148..27768167 61.15 60

*** Putative Vector Insertion (Chr 17: 27768144 - 27769302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139784 Chr17:27767374..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50
downstream ENSMUSE00000700895 Chr17:27767369..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50
downstream ENSMUSE00000700898 Chr17:27767367..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCCTGCACTCACAATATC Chr17:27769315..27769335 59.68 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCCTGCACTCACAATATC Chr17:27769315..27769335 59.68 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCCCGTGAGTATCTCCTCT Chr17:27769207..27769227 60.62 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCCCCGTGAGTATCTCCTCT Chr17:27769207..27769227 60.62 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052146