Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14936
Trapped Gene
F630043A04Rik (ENSMUSG00000021965)
Vector Insertion
Chr 14: 58430416 - 58435589
Public Clones PST10401-NL (escells) PST5403-NL (escells) PST190-3A (escells) PST190-1 (escells)
PST10484-NR (escells) PST190-1B (escells) PST190-2A (escells) PST7957-NR (escells)
PST194-1 (escells) IST12847C8 (tigm)
Private Clones OST425129 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000356670 (Chr14:58435482..58435588 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCTGGTCCCATAATCCAG Chr14:58435498..58435517 59.74 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000356670 (Chr14:58435482..58435588 -)
Downstram Exon
ENSMUSE00000122501 (Chr14:58430417..58430502 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCTGGTCCCATAATCCAG Chr14:58435498..58435517 59.74 50 GTGGCAATGGTGAACTTACG Chr14:58430451..58430470 59.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000402115 Chr14:58444847..58445000 TGAACCCCATCCAGAGTTTC Chr14:58444929..58444948 59.9 50
upstream ENSMUSE00000358836 Chr14:58441738..58441799 GGGAGAATTTTGCATGACCT Chr14:58441763..58441782 58.98 45
upstream ENSMUSE00000404945 Chr14:58440873..58441038 GCGTGACAAGGAGGATTCAG Chr14:58440873..58440892 60.8 55
upstream ENSMUSE00000122507 Chr14:58438991..58439399 ACCCCTCTGTTCAAGTGCTG Chr14:58439131..58439150 60.3 55
upstream ENSMUSE00000356670 Chr14:58435482..58435588 TTCCTGGTCCCATAATCCAG Chr14:58435498..58435517 59.74 50
upstream ENSMUSE00000122501 Chr14:58430417..58430502 TTCTGCACTCCTGGTTTGAA Chr14:58430448..58430467 59.42 45

*** Putative Vector Insertion (Chr 14: 58430416 - 58435589) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000383724 Chr14:58428780..58428980 CGCAGTAACTTTCGGAGGAG Chr14:58428779..58428798 60.01 55
downstream ENSMUSE00000339775 Chr14:58426812..58426915 TCCGTGGCATCACTTTAACA Chr14:58426833..58426852 60.11 45
downstream ENSMUSE00000459598 Chr14:58425398..58426368 CGGAAACATTCCCGTAAGAA Chr14:58426166..58426185 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATTGGATTAATCGCCTTG Chr14:58432527..58432547 58.58 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCCCTTTTGAGTGGTGTCA Chr14:58432567..58432588 60 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCAGCAGATGGAAGAAAACG Chr14:58432480..58432500 60.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCAGCAGATGGAAGAAAACG Chr14:58432480..58432500 60.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021965