Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14949
Trapped Gene
Pag1 (ENSMUSG00000027508)
Vector Insertion
Chr 3: 9787261 - 9833631
Public Clones PST7292-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000569541 (Chr3:9833211..9833630 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTTGCAGCGCTTTTTAG Chr3:9833244..9833263 60.15 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000569541 (Chr3:9833211..9833630 -)
Downstram Exon
ENSMUSE00000676569 (Chr3:9787262..9787320 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTTGCAGCGCTTTTTAG Chr3:9833244..9833263 60.15 50 CCCAGCTTTGAAGTTGTGCT Chr3:9787245..9787264 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000569541 Chr3:9833211..9833630 GGAGTTGCAGCGCTTTTTAG Chr3:9833244..9833263 60.15 50
upstream ENSMUSE00000676569 Chr3:9787262..9787320 CCACAGTGGAGCACAACTTC Chr3:9787276..9787295 59.31 55

*** Putative Vector Insertion (Chr 3: 9787261 - 9833631) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000569539 Chr3:9752413..9752486 GGAGAAACGGTTGTCCAGAA Chr3:9752394..9752413 60.09 50
downstream ENSMUSE00000376336 Chr3:9706083..9706289 GAGGACGAGGAAGGTGATGA Chr3:9706081..9706100 60.2 55
downstream ENSMUSE00000170173 Chr3:9704704..9704755 GTTCTCATGGTCCCCGCTAT Chr3:9704694..9704713 61.24 55
downstream ENSMUSE00000170171 Chr3:9701958..9702054 TGCTAGCCAGTGCATCTGTT Chr3:9701969..9701988 59.62 50
downstream ENSMUSE00000170167 Chr3:9699225..9699811 CAGAAGCTTAACCGGGACAG Chr3:9699284..9699303 59.87 55
downstream ENSMUSE00000170165 Chr3:9696119..9696178 GGGTCTTCTTCCCGAGACTT Chr3:9696116..9696135 59.68 55
downstream ENSMUSE00000676558 Chr3:9691774..9694129 GGGTGAAGTGCCAGTGTTTT Chr3:9693398..9693417 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:9788561..9788581 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATACCGTGACTGGGAAAACC Chr3:9788564..9788585 60.1 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027508