Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14952
Trapped Gene
Eif4ebp1 (ENSMUSG00000031490)
Vector Insertion
Chr 8: 28383975 - 28385551
Public Clones PST6661-NR (escells)
Private Clones OST292812 (lexicon) OST196416 (lexicon) OST196408 (lexicon) OST82674 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210028 (Chr8:28383795..28383974 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTAGCCCTACCAGCGATGAG Chr8:28383894..28383913 59.99 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210028 (Chr8:28383795..28383974 +)
Downstram Exon
ENSMUSE00000224813 (Chr8:28385552..28385985 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTAGCCCTACCAGCGATGAG Chr8:28383894..28383913 59.99 60 TACGGCTGGTCCCTTAAATG Chr8:28385599..28385618 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000210026 Chr8:28370850..28371022 GGGGACTACAGCACCACTCC Chr8:28370971..28370990 61.9 65
upstream ENSMUSE00000210028 Chr8:28383795..28383974 CTAGCCCTACCAGCGATGAG Chr8:28383894..28383913 59.99 60

*** Putative Vector Insertion (Chr 8: 28383975 - 28385551) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000224813 Chr8:28385552..28385985 TACGGCTGGTCCCTTAAATG Chr8:28385599..28385618 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCTGAACTGGAAGGAGGA Chr8:28383991..28384011 59.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTGAACTGGAAGGAGGA Chr8:28383991..28384011 59.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031490