Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14955
Trapped Gene
B230112C05Rik (ENSMUSG00000041817)
Vector Insertion
Chr 13: 97841667 - 97861772
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) P137A03 (ggtc) P102F06 (ggtc)
E048F03 (ggtc) D162B08 (ggtc) D104C01 (ggtc) D049E06 (ggtc) D015A09 (ggtc)
(ggtc) P149G01 (ggtc) P135B07 (ggtc) H005C01 (ggtc) E042C02 (ggtc)
D135E07 (ggtc) D073D08 (ggtc) D038C05 (ggtc) D007D04 (ggtc) 3SE284B09 (ggtc)
(ggtc) P137E05 (ggtc) P105H11 (ggtc) E067B06 (ggtc) D172G01 (ggtc)
D106C01 (ggtc) D050D08 (ggtc) D017E01 (ggtc) D005C12 (ggtc) 3SE314A11 (ggtc)
(ggtc) (ggtc) P151H01 (ggtc) P137A03 (ggtc) H005D01 (ggtc) E043C03 (ggtc)
D141C05 (ggtc) D086H03 (ggtc) D049E01 (ggtc) D010A05 (ggtc) 5SE285C05 (ggtc)
(ggtc) P147G02 (ggtc) P134A01 (ggtc) E129E03 (ggtc) E032D12 (ggtc)
D113A02 (ggtc) D054A07 (ggtc) D028H03 (ggtc) D005G07 (ggtc) 5SE314A12 (ggtc)
(ggtc) P137E05 (ggtc) P102F06 (ggtc) E063B08 (ggtc) D172D08 (ggtc)
D106C01 (ggtc) D050D08 (ggtc) D015A09 (ggtc) D001H12 (ggtc) (ggtc)
(ggtc) P149G01 (ggtc) P135B11 (ggtc) H005D01 (ggtc) E043C03 (ggtc)
D135E07 (ggtc) D086H03 (ggtc) D049E01 (ggtc) D010A05 (ggtc) 3SE285C05 (ggtc)
(ggtc) P140G01 (ggtc) P134A01 (ggtc) E070E08 (ggtc) E018G05 (ggtc)
D108E11 (ggtc) D054A07 (ggtc) D017E01 (ggtc) D005G07 (ggtc) 5SE314A11 (ggtc)
(ggtc) PST7896-NR (escells) PST23907-NR (escells) PST17351-NL (escells)
PST6270-NL (escells) PST22497-NR (escells) PST17250-NL (escells) PST14121-NR (escells)
PST24249-NR (escells) PST20414-NR (escells) PST16193-NL (escells) IST10070A7 (tigm)
IST14667H4 (tigm) IST10062F7 (tigm) IST14572C1 (tigm) IST10062H7 (tigm)
IST14382B4 (tigm) IST11670G1 (tigm) IST14390B10 (tigm) IST12058G9 (tigm)
IST10693A5 (tigm) IST12058G9 (tigm) IST10073A6 (tigm) IST13606E12 (tigm)
IST11686E9 (tigm) IST14530D2 (tigm) IST10261H9 (tigm) IST14616E8 (tigm)
IST14651A6 (tigm) IST10022B2 (tigm) IST13235C4 (tigm) IST14721D1 (tigm)
IST10993G10 (tigm) IST14289A2 (tigm) IST14009C9 (tigm) IST10281E10 (tigm)
IST14179F6 (tigm) IST14164G6 (tigm) IST14438D3 (tigm) IST14591C8 (tigm)
IST10075H2 (tigm) IST14332E7 (tigm) IST14219E9 (tigm) IST14579E7 (tigm)
Private Clones OST466949 (lexicon) OST451393 (lexicon) OST440935 (lexicon) OST427332 (lexicon)
OST423861 (lexicon) OST376617 (lexicon) OST369052 (lexicon) OST345123 (lexicon)
OST341873 (lexicon) OST330160 (lexicon) OST308350 (lexicon) OST303112 (lexicon)
OST302875 (lexicon) OST298106 (lexicon) OST297318 (lexicon) OST293471 (lexicon)
OST285397 (lexicon) OST285343 (lexicon) OST284301 (lexicon) OST281670 (lexicon)
OST276052 (lexicon) OST274136 (lexicon) OST266101 (lexicon) OST262262 (lexicon)
OST252498 (lexicon) OST251775 (lexicon) OST238835 (lexicon) OST237488 (lexicon)
OST237041 (lexicon) OST235675 (lexicon) OST232365 (lexicon) OST230449 (lexicon)
OST226738 (lexicon) OST226426 (lexicon) OST226245 (lexicon) OST223867 (lexicon)
OST221411 (lexicon) OST215598 (lexicon) OST215232 (lexicon) OST214753 (lexicon)
OST214040 (lexicon) OST213549 (lexicon) OST210801 (lexicon) OST207325 (lexicon)
OST201828 (lexicon) OST198731 (lexicon) OST188492 (lexicon) OST186692 (lexicon)
OST185763 (lexicon) OST185052 (lexicon) OST183153 (lexicon) OST179415 (lexicon)
OST170245 (lexicon) OST169169 (lexicon) OST167781 (lexicon) OST138990 (lexicon)
OST128490 (lexicon) OST126831 (lexicon) OST122247 (lexicon) OST112090 (lexicon)
OST99044 (lexicon) OST98461 (lexicon) OST87603 (lexicon) OST68018 (lexicon)
OST64672 (lexicon) OST63612 (lexicon) OST38591 (lexicon) OST34757 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000611533 (Chr13:97841598..97841666 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000611533 (Chr13:97841598..97841666 +)
Downstram Exon
ENSMUSE00000297815 (Chr13:97861773..97861907 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCCTCATGCGTGCAGTTATC Chr13:97861822..97861841 59.83 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000611533 Chr13:97841598..97841666 No primer for this exon

*** Putative Vector Insertion (Chr 13: 97841667 - 97861772) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297815 Chr13:97861773..97861907 TCCTCATGCGTGCAGTTATC Chr13:97861822..97861841 59.83 50
downstream ENSMUSE00000297810 Chr13:97863546..97863645 AGAGAATCTTCAGGCGCAAA Chr13:97863643..97863662 60.1 45
downstream ENSMUSE00000297805 Chr13:97864017..97864102 ATATCATCAATGGCCCACCA Chr13:97864065..97864084 60.95 45
downstream ENSMUSE00000297802 Chr13:97867495..97867666 AATAAAACCCAACGGCCTCT Chr13:97867654..97867673 59.83 45
downstream ENSMUSE00000569672 Chr13:97876909..97877088 AGCCCCAAATCTTTTCCTCT Chr13:97877008..97877027 59.17 45
downstream ENSMUSE00000569671 Chr13:97879978..97880106 TGACTGGTACTCGCTGATGC Chr13:97880073..97880092 60.02 55
downstream ENSMUSE00000297785 Chr13:97881251..97881357 GAGTGTCGTCCAGTCCAGGT Chr13:97881343..97881362 60.16 60
downstream ENSMUSE00000297780 Chr13:97883594..97883633 GGCATCTTTTAGGGAATGGA Chr13:97883617..97883636 58.97 45
downstream ENSMUSE00000297775 Chr13:97884064..97884214 GTACGCGTGGAAACAGGAGT Chr13:97884097..97884116 60.18 55
downstream ENSMUSE00000297771 Chr13:97888330..97888486 CTCTGATGTTCGTGCAGCAT Chr13:97888360..97888379 60.02 50
downstream ENSMUSE00000297764 Chr13:97892647..97892847 CTGGTGGAGTCCTCGTCTTC Chr13:97892735..97892754 59.83 60
downstream ENSMUSE00000397821 Chr13:97896451..97899470 GGCGCGTCTTCAAGTTCTAC Chr13:97896782..97896801 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAAAGTAATCGCCTTGCAG Chr13:97859711..97859732 59.9 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAATGAGTGAGCCAGACG Chr13:97859680..97859700 59.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041817