Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14963
Trapped Gene
Rps8 (ENSMUSG00000047675)
Vector Insertion
Chr 4: 116826440 - 116827034
Public Clones PST14752-NL (escells)
Private Clones OST85717 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000463465 (Chr4:116826904..116827033 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000463465 (Chr4:116826904..116827033 -)
Downstram Exon
ENSMUSE00000339525 (Chr4:116826441..116826592 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGGTCGTGAGGCAATACAG Chr4:116826550..116826569 59.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662321 Chr4:116828663..116828737 TTAGAAACCGGACCGTGAAG Chr4:116828701..116828720 60.1 50
upstream ENSMUSE00000705664 Chr4:116828663..116828689 No primer for this exon
upstream ENSMUSE00000662320 Chr4:116828176..116828282 GGGTAAGCGAAAACCCTACC Chr4:116828223..116828242 59.83 55
upstream ENSMUSE00000465282 Chr4:116827613..116827712 AGTACCGTGCCCTGAGATTG Chr4:116827644..116827663 60.13 55
upstream ENSMUSE00000464404 Chr4:116827243..116827418 ACCGACAGTGGTACGAGTCC Chr4:116827285..116827304 60.03 60
upstream ENSMUSE00000463465 Chr4:116826904..116827033 No primer for this exon
upstream ENSMUSE00000339525 Chr4:116826441..116826592 CTGTATTGCCTCACGACCAG Chr4:116826572..116826591 59.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCTTGTGACTTTCCTGGT Chr4:116827062..116827082 58.79 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCTTGTGACTTTCCTGGT Chr4:116827062..116827082 58.79 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCAGGGCAAGCTTCTAGGT Chr4:116826900..116826920 60.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCAGGGCAAGCTTCTAGGT Chr4:116826900..116826920 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047675