Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14974
Trapped Gene
Ncapd2 (ENSMUSG00000038252)
Vector Insertion
Chr 6: 125118026 - 125118767
Public Clones PST12506-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000243752 (Chr6:125118608..125118766 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTGGTCGTCCACAAACTC Chr6:125118674..125118693 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000243752 (Chr6:125118608..125118766 -)
Downstram Exon
ENSMUSE00000385544 (Chr6:125118027..125118337 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTGGTCGTCCACAAACTC Chr6:125118674..125118693 60.01 55 GAAAACAGCAATTGGCACAG Chr6:125118033..125118052 59.32 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341330 Chr6:125141516..125141613 GCGTATCCTGCCCTATTGTT Chr6:125141587..125141606 59.07 50
upstream ENSMUSE00000401504 Chr6:125139781..125139926 TGCTGAAAAGTGGAGGTGTG Chr6:125139839..125139858 59.87 50
upstream ENSMUSE00000243668 Chr6:125137095..125137170 CTCGCCATACTGGAGCACTT Chr6:125137119..125137138 60.42 55
upstream ENSMUSE00000243660 Chr6:125136772..125136830 AACCTGGCCTCAAGGAAGAC Chr6:125136794..125136813 60.63 55
upstream ENSMUSE00000243656 Chr6:125136118..125136299 AGGAACTGTCGTCCATCCTG Chr6:125136262..125136281 60.11 55
upstream ENSMUSE00000243650 Chr6:125135712..125135854 GCTGGACATCCGTCACCTAT Chr6:125135746..125135765 59.96 55
upstream ENSMUSE00000243641 Chr6:125134453..125134580 GCTACCGCCTTTTGGAGAAT Chr6:125134544..125134563 60.58 50
upstream ENSMUSE00000337778 Chr6:125134247..125134370 GTGACAGCCGTGAGTCTGTG Chr6:125134292..125134311 60.53 60
upstream ENSMUSE00000243905 Chr6:125133932..125134079 TGAGCTAGCAGAGCGAATCC Chr6:125133985..125134004 60.79 55
upstream ENSMUSE00000243897 Chr6:125130997..125131194 GGTGACCAGCTCGAAGAATC Chr6:125131112..125131131 59.81 55
upstream ENSMUSE00000243889 Chr6:125129713..125129847 GGCCAGCTTTCTAGCCAATA Chr6:125129730..125129749 59.46 50
upstream ENSMUSE00000243881 Chr6:125129531..125129618 ATTGACCTTGCTGGACCACT Chr6:125129590..125129609 59.58 50
upstream ENSMUSE00000243873 Chr6:125129256..125129430 TGTTGCCAGAATTGAAGTCG Chr6:125129375..125129394 59.84 45
upstream ENSMUSE00000243864 Chr6:125127827..125127942 CACTCGGGAAGCTACCAGTC Chr6:125127908..125127927 59.87 60
upstream ENSMUSE00000243856 Chr6:125127346..125127570 GGGCTGACAGGCAGTAAAGA Chr6:125127507..125127526 60.4 55
upstream ENSMUSE00000243850 Chr6:125126670..125126844 CTTAATGCGTACCGCCAACT Chr6:125126700..125126719 60.15 50
upstream ENSMUSE00000243843 Chr6:125126161..125126245 TCGCTGTTGTTAGTGGATGC Chr6:125126195..125126214 59.87 50
upstream ENSMUSE00000243838 Chr6:125124243..125124376 GAGCGCTGCTCCTCTGTTAT Chr6:125124264..125124283 59.75 55
upstream ENSMUSE00000243831 Chr6:125123798..125123930 AACATCTCGGACAGGAGGAA Chr6:125123799..125123818 59.65 50
upstream ENSMUSE00000243826 Chr6:125123619..125123703 CAGGAGCACAGGTTGTTTGA Chr6:125123645..125123664 59.87 50
upstream ENSMUSE00000243820 Chr6:125123378..125123542 AGAGCCCTGATGTGCTCTGT Chr6:125123451..125123470 60.02 55
upstream ENSMUSE00000243815 Chr6:125123008..125123180 TTGGAACAAGCAGTGAGTGG Chr6:125123075..125123094 59.87 50
upstream ENSMUSE00000243811 Chr6:125121851..125121965 CATCCGAAGCATCTGTGAGA Chr6:125121866..125121885 59.94 50
upstream ENSMUSE00000243807 Chr6:125121654..125121777 CCCTGGCTTATACAGCAACC Chr6:125121706..125121725 59.59 55
upstream ENSMUSE00000243800 Chr6:125121416..125121571 GCTATCCGCTTCCCTAACCT Chr6:125121449..125121468 59.71 55
upstream ENSMUSE00000243794 Chr6:125120934..125121111 CTCAACAAGTGCGGAAGACA Chr6:125121078..125121097 60.03 50
upstream ENSMUSE00000243787 Chr6:125120745..125120839 CTCCCCGATATCATCAGTCG Chr6:125120799..125120818 60.44 55
upstream ENSMUSE00000243779 Chr6:125120152..125120232 AAAAGCTGTGTCAGCGGTTC Chr6:125120163..125120182 60.44 50
upstream ENSMUSE00000243771 Chr6:125119833..125120016 GTGCTTTGGCGATAAGCTCT Chr6:125119907..125119926 59.62 50
upstream ENSMUSE00000243761 Chr6:125118881..125119007 GTCACACCAGAGGCATGGAT Chr6:125118951..125118970 60.97 55
upstream ENSMUSE00000243752 Chr6:125118608..125118766 ACCTGGTCGTCCACAAACTC Chr6:125118674..125118693 60.01 55
upstream ENSMUSE00000691073 Chr6:125118287..125118337 AAGAGACACCCAAGAGAACCAC Chr6:125118292..125118313 59.65 50
upstream ENSMUSE00000691072 Chr6:125118106..125118176 GGCCTTTGCATTGAGGTCTT Chr6:125118114..125118133 61.51 50
upstream ENSMUSE00000385544 Chr6:125118027..125118337 CCCCCTTGTAGAAGTGCTTG Chr6:125118159..125118178 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTACAGCCTCTGACTTCTG Chr6:125118738..125118759 59.25 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTTTGTCGTGACTGGGAAA Chr6:125118703..125118724 60.14 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038252