Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14977
Trapped Gene
Dppa4 (ENSMUSG00000058550)
Vector Insertion
Chr 16: 48288109 - 48289151
Public Clones PST10297-NR (escells) PST10673-NR (escells) PST3222-NR (escells) PST12439-NR (escells)
PST7901-NL (escells) PST11653-NR (escells) PST2567-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000488822 (Chr16:48287991..48288108 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGAAGAGCCGAAGGAAGAA Chr16:48287998..48288017 59.69 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000488822 (Chr16:48287991..48288108 +)
Downstram Exon
ENSMUSE00000618529 (Chr16:48289152..48289213 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGAAGAGCCGAAGGAAGAA Chr16:48287998..48288017 59.69 50 GTCTGTCCTGGCGTCTCAGT Chr16:48289206..48289225 60.47 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000129201 Chr16:48283848..48283954 GTCTTTTGGAAGCTGGGAGA Chr16:48283879..48283898 59.4 50
upstream ENSMUSE00000707235 Chr16:48283931..48283954 TGGAGACTGCTGGAGACAAG Chr16:48283932..48283951 59.12 55
upstream ENSMUSE00000488822 Chr16:48287991..48288108 CAGAAGAGCCGAAGGAAGAA Chr16:48287998..48288017 59.69 50

*** Putative Vector Insertion (Chr 16: 48288109 - 48289151) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000129203 Chr16:48289152..48289318 GGGGGCAGATACTCTGGAAT Chr16:48289251..48289270 60.29 55
downstream ENSMUSE00000618529 Chr16:48289152..48289213 GTCTGTCCTGGCGTCTCAGT Chr16:48289206..48289225 60.47 60
downstream ENSMUSE00000129208 Chr16:48289441..48289491 TTGTTCTGGGAAAGCCCTTG Chr16:48289491..48289510 62.41 50
downstream ENSMUSE00000331497 Chr16:48291127..48291427 TCAGGGACGTTCCTCAACTC Chr16:48291152..48291171 60.24 55
downstream ENSMUSE00000351172 Chr16:48291127..48291428 TCAGGGACGTTCCTCAACTC Chr16:48291152..48291171 60.24 55
downstream ENSMUSE00000336136 Chr16:48293024..48293219 CATGTTGTCCTCCAGGTGTG Chr16:48293199..48293218 60 55
downstream ENSMUSE00000699695 Chr16:48293024..48293093 CCATGAACCACACACCACAT Chr16:48293051..48293070 60.14 50
downstream ENSMUSE00000699694 Chr16:48293095..48293219 CATGTTGTCCTCCAGGTGTG Chr16:48293199..48293218 60 55
downstream ENSMUSE00000618530 Chr16:48293812..48294405 CATGCGGAGGCTACAGGTAT Chr16:48294265..48294284 60.12 55
downstream ENSMUSE00000707234 Chr16:48293812..48293845 TCCTTCGAGGCTCTTAGTCAA Chr16:48293844..48293864 59.21 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTCCTAATCGCCTTGCAG Chr16:48288154..48288174 60.33 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTAAAGCAACGGGGAAAA Chr16:48288063..48288083 63.44 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058550