Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14978
Trapped Gene
Il34 (ENSMUSG00000031750)
Vector Insertion
Chr 8: 113279130 - 113329773
Public Clones PST10227-NR (escells) IST13675E2 (tigm) IST12579H11 (tigm) IST14535E10 (tigm)
IST14578D6 (tigm) IST14591B8 (tigm) IST14506H12 (tigm) IST14835D5 (tigm)
IST14425H11 (tigm) IST14219A4 (tigm) IST13675E2 (tigm)
Private Clones OST447311 (lexicon) OST315345 (lexicon) OST149556 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000463463 (Chr8:113329634..113329772 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGACTGTAGAAGCCCACAT Chr8:113329650..113329669 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000463463 (Chr8:113329634..113329772 -)
Downstram Exon
ENSMUSE00000466224 (Chr8:113279131..113279550 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGACTGTAGAAGCCCACAT Chr8:113329650..113329669 60.28 55 GCCTTAGGTCAGCAAAGGTG Chr8:113279217..113279236 59.88 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000463463 Chr8:113329634..113329772 GCGACTGTAGAAGCCCACAT Chr8:113329650..113329669 60.28 55
upstream ENSMUSE00000466224 Chr8:113279131..113279550 ACCAGTTCCTGAGCTGCAAT Chr8:113279378..113279397 59.87 50

*** Putative Vector Insertion (Chr 8: 113279130 - 113329773) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000634404 Chr8:113273325..113273458 CCCAAAGCCACGTCAAGTAG Chr8:113273406..113273425 60.68 55
downstream ENSMUSE00000634403 Chr8:113272563..113272640 GTACCCCCTCATAAGGCACA Chr8:113272567..113272586 59.81 55
downstream ENSMUSE00000634402 Chr8:113272143..113272304 GCCCTCGAGAAGTACATCCA Chr8:113272187..113272206 60.22 55
downstream ENSMUSE00000311661 Chr8:113270718..113270835 GCTGGTGTCAAATGATCTGG Chr8:113270718..113270737 59.09 50
downstream ENSMUSE00000580056 Chr8:113266544..113266679 No primer for this exon
downstream ENSMUSE00000580059 Chr8:113266544..113266679 No primer for this exon
downstream ENSMUSE00000580058 Chr8:113265740..113266348 GCAAGATACGGCATTTGGTT Chr8:113265769..113265788 59.97 45
downstream ENSMUSE00000679407 Chr8:113265740..113266348 GCAAGATACGGCATTTGGTT Chr8:113265769..113265788 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCTGGCAGGCTCTGAATG Chr8:113323757..113323777 60.56 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTACCGTGACTGGGAAAAC Chr8:113302707..113302727 59.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTTTTAGGGTGGCAGTCGAG Chr8:113302656..113302676 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTTTTAGGGTGGCAGTCGAG Chr8:113302656..113302676 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031750