Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1498
Trapped Gene
Zfp60 (ENSMUSG00000037640)
Vector Insertion
Chr 7: 28523449 - 28525975
Public Clones CC0806 (sanger)
Private Clones OST230098 (lexicon) OST87057 (lexicon) OST40639 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000597848 (Chr7:28523322..28523448 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGATGTGGCTGTTGACTT Chr7:28523337..28523356 59.58 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000597848 (Chr7:28523322..28523448 +)
Downstram Exon
ENSMUSE00000597847 (Chr7:28525976..28526074 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGATGTGGCTGTTGACTT Chr7:28523337..28523356 59.58 50 TCTTTCTTCACAGCCATCCA Chr7:28526057..28526076 59.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676347 Chr7:28516408..28516489 TCGGGTCTTTCTGGTCTGAG Chr7:28516436..28516455 60.38 55
upstream ENSMUSE00000676350 Chr7:28516428..28516683 GTTTAGGGACGGTGCTGTGT Chr7:28516556..28516575 60.03 55
upstream ENSMUSE00000597846 Chr7:28521955..28522007 CCTGAAGAAGAATGGCCAAC Chr7:28521964..28521983 59.67 50
upstream ENSMUSE00000713205 Chr7:28521955..28522007 CCTGAAGAAGAATGGCCAAC Chr7:28521964..28521983 59.67 50
upstream ENSMUSE00000597848 Chr7:28523322..28523448 AGGGATGTGGCTGTTGACTT Chr7:28523337..28523356 59.58 50

*** Putative Vector Insertion (Chr 7: 28523449 - 28525975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000597847 Chr7:28525976..28526074 TCTTTCTTCACAGCCATCCA Chr7:28526057..28526076 59.37 45
downstream ENSMUSE00000563275 Chr7:28533187..28536708 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50
downstream ENSMUSE00000676346 Chr7:28533187..28538721 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGGATGTTTCCTCTACA Chr7:28523470..28523490 60.31 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGGGATGTTTCCTCTACA Chr7:28523470..28523490 60.31 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037640