Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14988
Trapped Gene
Rps27l (ENSMUSG00000036781)
Vector Insertion
Chr 9: 66794747 - 66795393
Public Clones CMHD-GT_545A1-3 (cmhd) PST14366-NR (escells) PST22378-NR (escells) PST2558-NR (escells)
PST24506-NR (escells)
Private Clones OST362766 (lexicon) OST358429 (lexicon) OST332581 (lexicon) OST328426 (lexicon)
OST284450 (lexicon) OST222930 (lexicon) OST218080 (lexicon) OST81344 (lexicon)
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000240972 (Chr9:66794638..66794746 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGAAACGGCTGGTTCAGA Chr9:66794691..66794710 60.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000240972 (Chr9:66794638..66794746 +)
Downstram Exon
ENSMUSE00000240947 (Chr9:66795394..66795504 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGAAACGGCTGGTTCAGA Chr9:66794691..66794710 60.38 50 TGGCACAACACAGTTGAACA Chr9:66795475..66795494 59.75 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000340744 Chr9:66793907..66793987 CTCGAAAGCGAGCAGTTCGT Chr9:66793922..66793941 63.06 55
upstream ENSMUSE00000240972 Chr9:66794638..66794746 GAAGAAACGGCTGGTTCAGA Chr9:66794691..66794710 60.38 50

*** Putative Vector Insertion (Chr 9: 66794747 - 66795393) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240947 Chr9:66795394..66795504 TGGCACAACACAGTTGAACA Chr9:66795475..66795494 59.75 45
downstream ENSMUSE00000398331 Chr9:66797136..66797319 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGTTCAGAGCCCAAATTC Chr9:66794702..66794722 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGATTCCGTGACTGGGAAAA Chr9:66794792..66794812 59.53 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036781