Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI14999
Trapped Gene
Trim59 (ENSMUSG00000034317)
Vector Insertion
Chr 3: 68839214 - 68847765
Public Clones (sanger) P103G04 (ggtc) P095B01 (ggtc) P151G10 (ggtc) PST10277-NR (escells)
PST6282-NL (escells) PST14038-NR (escells) PST8078-NR (escells) PST10533-NR (escells)
PST6740-NR (escells) PST23831-NR (escells) PST14772-NR (escells) PSTVU02.PA17-2 (vanderbilt)
IST14655F1 (tigm) IST14977E2 (tigm)
Private Clones OST316001 (lexicon) OST308358 (lexicon) OST288557 (lexicon) OST252175 (lexicon)
OST197826 (lexicon) OST105137 (lexicon) OST59245 (lexicon) OST41680 (lexicon)
OST33539 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000674481 (Chr3:68847690..68847764 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000674481 (Chr3:68847690..68847764 -)
Downstram Exon
ENSMUSE00000462170 (Chr3:68839215..68841930 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000674482 Chr3:68848535..68848677 No primer for this exon
upstream ENSMUSE00000229097 Chr3:68847690..68847765 AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86
upstream ENSMUSE00000674481 Chr3:68847690..68847764 AAGGATCCTGGAAAAGTTGGA Chr3:68847737..68847757 59.93 42.86
upstream ENSMUSE00000462170 Chr3:68839215..68841930 AATTGATGAAGTCCGCCAAC Chr3:68841150..68841169 59.94 45

*** Putative Vector Insertion (Chr 3: 68839214 - 68847765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487464 Chr3:68839210..68841930 AGCCAGCAGTCCAGACACTT Chr3:68840053..68840072 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr3:68847697..68847717 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCTGCGAATTCCACTCAA Chr3:68847762..68847782 61.32 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGCTGCTACGGTTGTTTTTG Chr3:68844672..68844692 59.91 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGCTGCTACGGTTGTTTTTG Chr3:68844672..68844692 59.91 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034317