Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15010
Trapped Gene
Dnajb6 (ENSMUSG00000029131)
Vector Insertion
Chr 5: 30091071 - 30092045
Public Clones PST14603-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185972 (Chr5:30090939..30091070 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTCCCCGAGGAAATAGAAG Chr5:30090974..30090993 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185972 (Chr5:30090939..30091070 +)
Downstram Exon
ENSMUSE00000185973 (Chr5:30092046..30092187 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTCCCCGAGGAAATAGAAG Chr5:30090974..30090993 59.9 55 ATTTGAAGTTGCCCATTCCA Chr5:30092138..30092157 60.31 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700760 Chr5:30062480..30062656 TGACGCACTTCCTGTTTGTT Chr5:30062508..30062527 59.34 45
upstream ENSMUSE00000185970 Chr5:30062568..30062656 No primer for this exon
upstream ENSMUSE00000185974 Chr5:30074885..30074975 TGCCTCACCTGAGGACATTA Chr5:30074949..30074968 59.24 50
upstream ENSMUSE00000710480 Chr5:30074885..30074975 TGCCTCACCTGAGGACATTA Chr5:30074949..30074968 59.24 50
upstream ENSMUSE00000185969 Chr5:30077478..30077587 AAGCAGAGCGGAAGTTCAAA Chr5:30077534..30077553 60.13 45
upstream ENSMUSE00000185979 Chr5:30078937..30078999 GCGGGACATCTACGACAAAT Chr5:30078944..30078963 59.96 50
upstream ENSMUSE00000185975 Chr5:30080082..30080192 CGGAACCCAGATGATGTCTT Chr5:30080126..30080145 59.93 50
upstream ENSMUSE00000185978 Chr5:30082774..30082878 GGATTTTCGCACAGGAAAAG Chr5:30082807..30082826 59.69 45
upstream ENSMUSE00000185980 Chr5:30084088..30084419 GCTCAGCGAGGAGTATGAGG Chr5:30084338..30084357 60.12 60
upstream ENSMUSE00000185972 Chr5:30090939..30091070 GGTCCCCGAGGAAATAGAAG Chr5:30090974..30090993 59.9 55

*** Putative Vector Insertion (Chr 5: 30091071 - 30092045) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185973 Chr5:30092046..30092187 ATTTGAAGTTGCCCATTCCA Chr5:30092138..30092157 60.31 40
downstream ENSMUSE00000655112 Chr5:30092865..30092935 TTTCTTGACCGTTCTCCACA Chr5:30092890..30092909 59.26 45
downstream ENSMUSE00000700759 Chr5:30092865..30093643 GCGTAGCAGGTGCTCCTTAC Chr5:30092958..30092977 60.04 60
downstream ENSMUSE00000655109 Chr5:30107670..30107990 CCTGTCCTGCTCGTCATCTT Chr5:30107950..30107969 60.41 55
downstream ENSMUSE00000655108 Chr5:30111571..30111653 TCCTCTTGCCACCTTCTTTG Chr5:30111597..30111616 60.37 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGTGGATTTCCTGCTTTT Chr5:30091044..30091065 59.58 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGTGGATTTCCTGCTTTT Chr5:30091044..30091065 59.58 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029131