Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15012
Trapped Gene
Pop1 (ENSMUSG00000022325)
Vector Insertion
Chr 15: 34432234 - 34434713
Public Clones PST14580-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000254839 (Chr15:34432066..34432233 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTGGAACCTCAAGGCAGT Chr15:34432073..34432092 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000254839 (Chr15:34432066..34432233 +)
Downstram Exon
ENSMUSE00000125612 (Chr15:34434714..34434889 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTGGAACCTCAAGGCAGT Chr15:34432073..34432092 59.84 50 TCCTGCAACCGTCTAGGAAG Chr15:34434876..34434895 60.39 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422489 Chr15:34425087..34425170 CTGTGGTGGGAGCTTCTAGG Chr15:34425099..34425118 59.86 60
upstream ENSMUSE00000254850 Chr15:34429044..34429187 GAAACCAGCCCAGTAACGTG Chr15:34429086..34429105 60.55 55
upstream ENSMUSE00000254839 Chr15:34432066..34432233 TTCTGGAACCTCAAGGCAGT Chr15:34432073..34432092 59.84 50

*** Putative Vector Insertion (Chr 15: 34432234 - 34434713) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000125612 Chr15:34434714..34434889 TCCTGCAACCGTCTAGGAAG Chr15:34434876..34434895 60.39 55
downstream ENSMUSE00000125614 Chr15:34436174..34436422 GTGACATCTTCGGGCTTTGT Chr15:34436245..34436264 60.12 50
downstream ENSMUSE00000125602 Chr15:34437875..34437962 CCTTTCAACTCCAAACAGCAG Chr15:34437911..34437931 59.9 47.62
downstream ENSMUSE00000125610 Chr15:34438359..34438546 CATCCTCTGGGGTCATCCTA Chr15:34438499..34438518 59.88 55
downstream ENSMUSE00000125608 Chr15:34439518..34439774 CACTCTCCCCATCGTCTCTC Chr15:34439686..34439705 59.79 60
downstream ENSMUSE00000125609 Chr15:34440087..34440180 AGTGCGAAAGAGGGCCTATC Chr15:34440142..34440161 60.73 55
downstream ENSMUSE00000125611 Chr15:34441669..34441780 TCCTGCAAGTGTCAGTCCAC Chr15:34441726..34441745 59.87 55
downstream ENSMUSE00000125601 Chr15:34442487..34442606 TGGAATTTCTGCTGGTGATG Chr15:34442515..34442534 59.65 45
downstream ENSMUSE00000368966 Chr15:34442845..34442934 TTCCAATGAGCACAAGACCA Chr15:34442908..34442927 60.24 45
downstream ENSMUSE00000125607 Chr15:34445597..34445712 AGCTGCTTCACTCGCTCATT Chr15:34445621..34445640 60.31 50
downstream ENSMUSE00000125606 Chr15:34447582..34447773 TCACGAGCCCCTAAATCAAG Chr15:34447649..34447668 60.21 50
downstream ENSMUSE00000125605 Chr15:34455918..34456072 ACTCGTGCACCTCGGTAGAT Chr15:34455940..34455959 59.75 55
downstream ENSMUSE00000125604 Chr15:34458638..34458985 GCACCAGGCATTGAAGCTAT Chr15:34458781..34458800 60.24 50
downstream ENSMUSE00000683718 Chr15:34459618..34460402 TTCCACGCAGTTCCACAATA Chr15:34460376..34460395 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTTTGTAATCGCCTTGCAG Chr15:34432278..34432299 60.03 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGCGTGACTGGGAAAAC Chr15:34432280..34432300 60.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022325