Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15028
Trapped Gene
Higd2a (ENSMUSG00000025868)
Vector Insertion
Chr 13: 54691781 - 54692084
Public Clones PST14364-NR (escells) PST1332-1 (escells)
Private Clones OST452440 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000153722 (Chr13:54691598..54691780 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGTTATCGAGGGCTTCAG Chr13:54691681..54691700 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000153722 (Chr13:54691598..54691780 +)
Downstram Exon
ENSMUSE00000386169 (Chr13:54692085..54692509 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGTTATCGAGGGCTTCAG Chr13:54691681..54691700 59.83 55 CTACGACCGTGAAACCCTGT Chr13:54692207..54692226 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000153722 Chr13:54691598..54691780 CCAGTTATCGAGGGCTTCAG Chr13:54691681..54691700 59.83 55

*** Putative Vector Insertion (Chr 13: 54691781 - 54692084) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386169 Chr13:54692085..54692509 CTACGACCGTGAAACCCTGT Chr13:54692207..54692226 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAGGACAGCGGTTTCGTA Chr13:54691811..54691831 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGGACAGCGGTTTCGTA Chr13:54691811..54691831 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025868