Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15043
Trapped Gene
Ppp1r10 (ENSMUSG00000039220)
Vector Insertion
Chr 17: 36054662 - 36060252
Public Clones (sanger) (sanger) (sanger) (sanger) E078C11 (ggtc) (ggtc)
P123D06 (ggtc) D034B06 (ggtc) P135H12 (ggtc) (ggtc) E078C11 (ggtc)
D022A03 (ggtc) (ggtc) P135H12 (ggtc) (ggtc) PST14209-NL (escells) IST11093B1 (tigm)
IST14193F9 (tigm) IST11183C8 (tigm) IST11722B1 (tigm) IST14414H4 (tigm)
IST14793G3 (tigm) IST11093B1 (tigm)
Private Clones OST376074 (lexicon) OST351989 (lexicon) OST346550 (lexicon) OST291553 (lexicon)
OST280275 (lexicon) OST210198 (lexicon) OST112408 (lexicon) OST95998 (lexicon)
OST92599 (lexicon) OST80793 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696937 (Chr17:36054143..36054661 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCCCCACAAGTAACTGA Chr17:36054547..36054566 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696937 (Chr17:36054143..36054661 +)
Downstram Exon
ENSMUSE00000401990 (Chr17:36060253..36060370 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCCCCACAAGTAACTGA Chr17:36054547..36054566 60.11 55 CTTTGGGGTCTATGGGACCT Chr17:36060294..36060313 60.18 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696938 Chr17:36053511..36053543 GGACCAGTCACGATGAATCC Chr17:36053513..36053532 60.33 55
upstream ENSMUSE00000544178 Chr17:36054141..36054661 GAGGCCCCACAAGTAACTGA Chr17:36054547..36054566 60.11 55
upstream ENSMUSE00000696937 Chr17:36054143..36054661 GAGGCCCCACAAGTAACTGA Chr17:36054547..36054566 60.11 55

*** Putative Vector Insertion (Chr 17: 36054662 - 36060252) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000401990 Chr17:36060253..36060370 CTTTGGGGTCTATGGGACCT Chr17:36060294..36060313 60.18 55
downstream ENSMUSE00000710787 Chr17:36060253..36060370 CTTTGGGGTCTATGGGACCT Chr17:36060294..36060313 60.18 55
downstream ENSMUSE00000271882 Chr17:36060982..36061068 TCTTTCGTGCCTCCTTCATT Chr17:36061007..36061026 59.81 45
downstream ENSMUSE00000271851 Chr17:36061190..36061325 CTTGTAGCCACCGACATCAA Chr17:36061217..36061236 59.72 50
downstream ENSMUSE00000271828 Chr17:36061803..36061854 TTGACTTGCTGAGCTGCTTC Chr17:36061845..36061864 59.47 50
downstream ENSMUSE00000354294 Chr17:36063147..36063224 CTACTCTGGGAGCGGATGAC Chr17:36063213..36063232 59.83 60
downstream ENSMUSE00000271739 Chr17:36063345..36063518 ATGACTGGGTGCCGTAGTTC Chr17:36063502..36063521 60 55
downstream ENSMUSE00000271719 Chr17:36063717..36063822 TCTTCTTCACAGGCACCAAA Chr17:36063761..36063780 59.42 45
downstream ENSMUSE00000271697 Chr17:36063919..36064031 GGCTGTGTTGAGAGGCTTGT Chr17:36063988..36064007 60.45 55
downstream ENSMUSE00000271680 Chr17:36064855..36064955 GCAGTCGGCGATAGTACCTT Chr17:36064951..36064970 59.36 55
downstream ENSMUSE00000271660 Chr17:36065127..36065274 CTCTGCTCGGTGCTTGTTTT Chr17:36065167..36065186 60.57 50
downstream ENSMUSE00000271647 Chr17:36065348..36065506 CCTCAGGCCAAGTCACAGTT Chr17:36065458..36065477 60.3 55
downstream ENSMUSE00000271631 Chr17:36065597..36065843 GATGTATCGCTCCTGGCTGT Chr17:36065793..36065812 60.25 55
downstream ENSMUSE00000271611 Chr17:36066166..36066229 ATGGGTTCATATGGCTCAGG Chr17:36066204..36066223 59.77 50
downstream ENSMUSE00000271590 Chr17:36066337..36066531 CTCCCATGCTTCCCATAAGA Chr17:36066466..36066485 60.03 50
downstream ENSMUSE00000271566 Chr17:36066718..36066793 CAGCATCTGCTTGAGCTTGT Chr17:36066795..36066814 59.34 50
downstream ENSMUSE00000271539 Chr17:36066996..36067109 GAAATGCTGCATACCCTTCG Chr17:36067084..36067103 60.61 50
downstream ENSMUSE00000401389 Chr17:36067237..36067554 GTGGTGGGGGACCTAAGAGA Chr17:36067296..36067315 61.28 60
downstream ENSMUSE00000544177 Chr17:36067237..36067836 GACATCATGTGGTCGGTGTC Chr17:36067724..36067743 59.81 55
downstream ENSMUSE00000544180 Chr17:36067597..36067836 GACATCATGTGGTCGGTGTC Chr17:36067724..36067743 59.81 55
downstream ENSMUSE00000544175 Chr17:36068094..36069217 TGTTCTCATAGCGGCAGTTG Chr17:36068159..36068178 60.01 50
downstream ENSMUSE00000544179 Chr17:36068094..36068203 TGTTCTCATAGCGGCAGTTG Chr17:36068159..36068178 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCATGGACCTTGTTTTCTG Chr17:36057623..36057643 59.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCATGGACCTTGTTTTCTG Chr17:36057623..36057643 59.69 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039220