Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15052
Trapped Gene
Znf512b (ENSMUSG00000000823)
Vector Insertion
Chr 2: 181324077 - 181325318
Public Clones PST14074-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000170907 (Chr2:181325175..181325317 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000170907 (Chr2:181325175..181325317 -)
Downstram Exon
ENSMUSE00000678028 (Chr2:181324078..181324886 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708246 Chr2:181327126..181327166 No primer for this exon
upstream ENSMUSE00000712738 Chr2:181327126..181327166 No primer for this exon
upstream ENSMUSE00000170892 Chr2:181325565..181325690 No primer for this exon
upstream ENSMUSE00000678029 Chr2:181325565..181325690 No primer for this exon
upstream ENSMUSE00000713914 Chr2:181325565..181325690 No primer for this exon
upstream ENSMUSE00000170907 Chr2:181325175..181325317 No primer for this exon
upstream ENSMUSE00000476011 Chr2:181324758..181324886 No primer for this exon
upstream ENSMUSE00000170904 Chr2:181324078..181324664 No primer for this exon
upstream ENSMUSE00000678028 Chr2:181324078..181324886 No primer for this exon

*** Putative Vector Insertion (Chr 2: 181324077 - 181325318) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000170900 Chr2:181323784..181323992 No primer for this exon
downstream ENSMUSE00000170893 Chr2:181323611..181323682 No primer for this exon
downstream ENSMUSE00000170908 Chr2:181323360..181323506 No primer for this exon
downstream ENSMUSE00000170898 Chr2:181323101..181323225 No primer for this exon
downstream ENSMUSE00000170905 Chr2:181322919..181323011 No primer for this exon
downstream ENSMUSE00000170906 Chr2:181322686..181322784 No primer for this exon
downstream ENSMUSE00000170896 Chr2:181322434..181322604 No primer for this exon
downstream ENSMUSE00000170894 Chr2:181321752..181321946 No primer for this exon
downstream ENSMUSE00000170899 Chr2:181321424..181321525 No primer for this exon
downstream ENSMUSE00000170902 Chr2:181321004..181321066 No primer for this exon
downstream ENSMUSE00000170897 Chr2:181320378..181320476 No primer for this exon
downstream ENSMUSE00000344281 Chr2:181316840..181319778 No primer for this exon
downstream ENSMUSE00000678026 Chr2:181316808..181319778 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTAATCGCCTTGCAGCAC Chr2:181325250..181325270 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACTCGTGACTGGGAAAAC Chr2:181325252..181325272 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000823