Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15053
Trapped Gene
Hirip3 (ENSMUSG00000042606)
Vector Insertion
Chr 7: 134006441 - 134006682
Public Clones E078E09 (ggtc) PST14062-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000339006 (Chr7:134006332..134006440 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCAGTGACCCAAAGAAG Chr7:134006393..134006412 60.82 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000339006 (Chr7:134006332..134006440 +)
Downstram Exon
ENSMUSE00000369751 (Chr7:134006683..134007764 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCAGTGACCCAAAGAAG Chr7:134006393..134006412 60.82 55 CTCCTCCTGGCAGTTAGCAC Chr7:134007080..134007099 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000339090 Chr7:134005953..134006030 CGAAAATTCACTCGCAGCTT Chr7:134005987..134006006 60.52 45
upstream ENSMUSE00000384940 Chr7:134006114..134006234 AAGAGAAGCAGGCGTTGAAG Chr7:134006182..134006201 59.76 50
upstream ENSMUSE00000339006 Chr7:134006332..134006440 CCTGCAGTGACCCAAAGAAG Chr7:134006393..134006412 60.82 55

*** Putative Vector Insertion (Chr 7: 134006441 - 134006682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000369751 Chr7:134006683..134007764 CTCCTCCTGGCAGTTAGCAC Chr7:134007080..134007099 60.01 60
downstream ENSMUSE00000292742 Chr7:134007834..134007999 CACCACAGGCTCGAATGTAA Chr7:134007906..134007925 59.72 50
downstream ENSMUSE00000292736 Chr7:134008077..134008175 GCGACACTTCTCCAAGGAAG Chr7:134008105..134008124 59.99 55
downstream ENSMUSE00000361296 Chr7:134008248..134008636 CTGTCACCGTCACTGCTGAT Chr7:134008407..134008426 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGTGACCCAAAGAAGAA Chr7:134006396..134006416 59.42 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCATCATTGGTCGTGACTG Chr7:134006480..134006500 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042606