Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15056
Trapped Gene
Myo10 (ENSMUSG00000022272)
Vector Insertion
Chr 15: 25683076 - 25705775
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (ggtc) (ggtc) P141F01 (ggtc) P104A12 (ggtc) E140C07 (ggtc)
E062E07 (ggtc) E023D06 (ggtc) D119F04 (ggtc) D068H09 (ggtc) (ggtc)
P134G12 (ggtc) P103F07 (ggtc) E113F01 (ggtc) E036F11 (ggtc) E002C08 (ggtc)
D103A07 (ggtc) D032D07 (ggtc) (ggtc) (ggtc) H005H04 (ggtc) P133A04 (ggtc)
H004D02 (ggtc) E067D08 (ggtc) E025A02 (ggtc) D154E05 (ggtc) D086F12 (ggtc)
D005D10 (ggtc) (ggtc) (ggtc) P139F01 (ggtc) P104A12 (ggtc) E140B02 (ggtc)
E043A08 (ggtc) E023D06 (ggtc) D111A02 (ggtc) D063G07 (ggtc) (ggtc)
P134G12 (ggtc) M123A10 (ggtc) E069A06 (ggtc) E035F07 (ggtc) D178H06 (ggtc)
D103A07 (ggtc) D032D07 (ggtc) (ggtc) (ggtc) P141F01 (ggtc) P116H07 (ggtc)
E323C01 (ggtc) E067D08 (ggtc) E025A01 (ggtc) D119F04 (ggtc) D068H09 (ggtc)
(ggtc) P138G10 (ggtc) P103F07 (ggtc) E140B02 (ggtc) E042A02 (ggtc)
E002C08 (ggtc) D111A02 (ggtc) D041D12 (ggtc) (ggtc) P133A04 (ggtc)
H008D10 (ggtc) E068A06 (ggtc) E032A05 (ggtc) D178H06 (ggtc) D100C07 (ggtc)
D005D10 (ggtc) CMHD-GT_534G1-5S (cmhd) CMHD-GT_534G1-3 (cmhd) CMHD-GT_494G1-3 (cmhd)
CMHD-GT_524H8-5S (cmhd) CMHD-GT_534F7-5S (cmhd) (cmhd) CMHD-GT_538B1-3 (cmhd)
CMHD-GT_403E6-3 (cmhd) CMHD-GT_521E5-5S (cmhd) CMHD-GT_522H8-5S (cmhd) (cmhd)
CMHD-GT_426A11-3 (cmhd) CMHD-GT_493A8-3 (cmhd) PST22895-NL (escells) PST17229-NR (escells)
PST14042-NL (escells) PST23200-NR (escells) PST4523-NL (escells) PST24693-NR (escells)
PST20433-NR (escells) IST10653E6BBF1 (tigm) IST12762F8 (tigm) IST14658C1 (tigm)
IST10038B1 (tigm) IST12126E8 (tigm) IST13323E6 (tigm) IST15000E12 (tigm)
IST14543H6 (tigm) IST12536F6 (tigm) IST10750C11 (tigm) IST14276H8 (tigm)
IST11764C10 (tigm) IST13063E1 (tigm) IST10882E10 (tigm) IST10991E7 (tigm)
IST12605A9 (tigm) IST14154A2 (tigm) IST13117A7 (tigm) IST12379D2 (tigm)
IST12007C8 (tigm) IST12124C6 (tigm) IST14558D5 (tigm) IST14685E5 (tigm)
IST14194G6 (tigm) IST13072A4 (tigm) IST14781F7 (tigm) IST10768C7 (tigm)
IST10156G4 (tigm) IST14685E5 (tigm) IST11078D11 (tigm) IST14390F2 (tigm)
IST14394F11 (tigm) IST13117A7 (tigm) IST10991E7 (tigm) IST14244B9 (tigm)
IST10761E12 (tigm) IST12953D6 (tigm) IST12229F6 (tigm) IST13114H9 (tigm)
IST12007C8 (tigm) IST12596E4 (tigm) IST12536F6 (tigm) IST14804H8 (tigm)
IST13059A2 (tigm) IST10510H5 (tigm) IST11772C3 (tigm) IST13111H7 (tigm)
IST11198E12 (tigm) IST13910A8 (tigm) IST14999C9 (tigm) IST13102F7 (tigm)
IST13111B4 (tigm) IST11119G9 (tigm) IST14118A4 (tigm) IST14431G5 (tigm)
IST14433F8 (tigm) IST12443B12HMF1 (tigm) IST10768C8 (tigm) IST15010E10 (tigm)
IST14475C6 (tigm) IST13894C1 (tigm) IST12783G6 (tigm) IST13640B2 (tigm)
IST12372G10 (tigm) IST12711G4 (tigm) IST11764C10 (tigm) IST12234H2 (tigm)
IST14405C11 (tigm) IST11024F7 (tigm) IST14807A9 (tigm) IST14724A9 (tigm)
IST14632D4 (tigm) IST10506E10 (tigm) IST14949B6 (tigm) IST14353F6 (tigm)
IST12502D8 (tigm) IST12732A2 (tigm) IST10884F5 (tigm) IST12372G10 (tigm)
IST12738E11 (tigm) IST12003D12 (tigm) IST14843G3 (tigm) IST13087D6 (tigm)
IST14430H6 (tigm) IST10831B3 (tigm) IST12986H11 (tigm) IST13613H11 (tigm)
IST12126E8 (tigm) IST13856A4 (tigm) IST14341D10 (tigm) IST11587A12 (tigm)
IST10189B5 (tigm) IST14583F5 (tigm) IST12988D9 (tigm) IST12635E12 (tigm)
IST11784F1 (tigm) IST11622B7 (tigm) IST13526G8 (tigm) IST14807A9 (tigm)
IST10205B4 (tigm) IST14586A2 (tigm) IST14379C10 (tigm) IST12234H2 (tigm)
IST13118A9 (tigm) IST11601A3 (tigm) IST12228E7 (tigm) IST11128G3 (tigm)
IST14484C7 (tigm) IST10043C3 (tigm) IST11137G7 (tigm) IST13017A1 (tigm)
IST14656G5 (tigm) IST12267E3BBF1 (tigm) IST12977E9 (tigm) IST10156G4 (tigm)
IST14164D1 (tigm) IST14857G9 (tigm) IST14426H6 (tigm) IST14958A11 (tigm)
IST14857G9 (tigm) IST14222G12 (tigm) IST14672D6 (tigm) IST14724A9 (tigm)
IST14466F6 (tigm) IST13041D3 (tigm) IST12407F6 (tigm) IST14271E5 (tigm)
IST14849F5 (tigm) IST14749C4 (tigm) IST12443H8 (tigm) IST10667D8 (tigm)
IST11024F7 (tigm) IST13082B10 (tigm) IST12769H12 (tigm) IST12528D6 (tigm)
IST10205B4 (tigm) IST15044F3 (tigm) IST12933G4 (tigm) IST14274G1 (tigm)
IST12077B7 (tigm) IST12844E8 (tigm) IST13058A6 (tigm) IST13286B11 (tigm)
IST14932D6 (tigm) IST13072E10 (tigm) IST10877E12 (tigm) IST12407F5 (tigm)
IST15079H10 (tigm) IST14787G12 (tigm) IST14158H8 (tigm)
Private Clones OST456642 (lexicon) OST453247 (lexicon) OST451177 (lexicon) OST449275 (lexicon)
OST443380 (lexicon) OST428426 (lexicon) OST428414 (lexicon) OST414587 (lexicon)
OST403938 (lexicon) OST378969 (lexicon) OST375823 (lexicon) OST355574 (lexicon)
OST334307 (lexicon) OST321602 (lexicon) OST303562 (lexicon) OST301464 (lexicon)
OST300200 (lexicon) OST296475 (lexicon) OST290687 (lexicon) OST285270 (lexicon)
OST282595 (lexicon) OST277031 (lexicon) OST260377 (lexicon) OST236973 (lexicon)
OST232072 (lexicon) OST223207 (lexicon) OST218706 (lexicon) OST217917 (lexicon)
OST213127 (lexicon) OST212259 (lexicon) OST210338 (lexicon) OST205288 (lexicon)
OST205155 (lexicon) OST201231 (lexicon) OST199933 (lexicon) OST196612 (lexicon)
OST194188 (lexicon) OST194141 (lexicon) OST193526 (lexicon) OST191604 (lexicon)
OST188832 (lexicon) OST187572 (lexicon) OST184143 (lexicon) OST180176 (lexicon)
OST180152 (lexicon) OST180134 (lexicon) OST170735 (lexicon) OST168943 (lexicon)
OST168696 (lexicon) OST168203 (lexicon) OST168053 (lexicon) OST136183 (lexicon)
OST131816 (lexicon) OST131566 (lexicon) OST125900 (lexicon) OST118025 (lexicon)
OST112671 (lexicon) OST108253 (lexicon) OST105172 (lexicon) OST100816 (lexicon)
OST99809 (lexicon) OST98856 (lexicon) OST97085 (lexicon) OST96159 (lexicon)
OST77147 (lexicon) OST77014 (lexicon) OST67959 (lexicon) OST64155 (lexicon)
OST63490 (lexicon) OST54631 (lexicon) OST40145 (lexicon) OST38931 (lexicon)
OST38735 (lexicon) OST36418 (lexicon) OST33785 (lexicon) OST33700 (lexicon)
OST32791 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684000 (Chr15:25682743..25683075 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAATGGCACCTATGGTCAA Chr15:25682813..25682832 59.92 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684000 (Chr15:25682743..25683075 +)
Downstram Exon
ENSMUSE00000562961 (Chr15:25705776..25705900 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAATGGCACCTATGGTCAA Chr15:25682813..25682832 59.92 45 ATACCCTGCTTTCCGAATCC Chr15:25705868..25705887 60.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000624397 Chr15:25552280..25552785 GTTTGCTGGTGATCCGAAGT Chr15:25552371..25552390 60.12 50
upstream ENSMUSE00000684011 Chr15:25595399..25595411 No primer for this exon
upstream ENSMUSE00000684010 Chr15:25596176..25596279 CACGGGTCTGGCTAAGAGAA Chr15:25596185..25596204 60.39 55
upstream ENSMUSE00000451753 Chr15:25596181..25596279 CACGGGTCTGGCTAAGAGAA Chr15:25596185..25596204 60.39 55
upstream ENSMUSE00000563015 Chr15:25631317..25631475 AGCGCTACAAAAGGAACCAA Chr15:25631450..25631469 59.88 45
upstream ENSMUSE00000563013 Chr15:25643784..25643971 AACGAATGCTATCGCTGCTT Chr15:25643916..25643935 60.01 45
upstream ENSMUSE00000563011 Chr15:25651925..25652059 AGTTCCTGTCCGTCATCAGC Chr15:25651972..25651991 60.27 55
upstream ENSMUSE00000464787 Chr15:25653639..25653763 TTGGCAATGCGAAGACAGTA Chr15:25653656..25653675 60.4 45
upstream ENSMUSE00000649969 Chr15:25654827..25654840 No primer for this exon
upstream ENSMUSE00000486227 Chr15:25654951..25655035 CCGGGGAGAGGAATTATCAC Chr15:25654973..25654992 60.65 55
upstream ENSMUSE00000483446 Chr15:25656175..25656278 TGGGTGTACGGAAGACAAGA Chr15:25656224..25656243 59.13 50
upstream ENSMUSE00000484558 Chr15:25661725..25661854 TGCATCTCGGCAACATAGAG Chr15:25661795..25661814 59.97 50
upstream ENSMUSE00000489860 Chr15:25663743..25663861 GAGATCCTGACGCCTCTCAG Chr15:25663832..25663851 60.1 60
upstream ENSMUSE00000563006 Chr15:25665701..25665847 ACTTCAAATCCATCGGCATC Chr15:25665798..25665817 59.9 45
upstream ENSMUSE00000563004 Chr15:25666156..25666256 TGCAAATGAAAAGCTTCAGG Chr15:25666188..25666207 59.04 40
upstream ENSMUSE00000563002 Chr15:25666350..25666416 GGGATTGGTGTGGGAAGATA Chr15:25666353..25666372 59.6 50
upstream ENSMUSE00000563001 Chr15:25667205..25667297 CCATTTTCCTCAAGCCACAG Chr15:25667240..25667259 60.63 50
upstream ENSMUSE00000562998 Chr15:25667712..25667780 TCAACAATTTTGGCGTGAAG Chr15:25667746..25667765 59.71 40
upstream ENSMUSE00000562997 Chr15:25669042..25669124 CGAGGCATCTTGGAAAAGAA Chr15:25669057..25669076 60.32 45
upstream ENSMUSE00000562995 Chr15:25672096..25672204 CTGTCAGCTCGCAGTTCAAG Chr15:25672185..25672204 59.92 55
upstream ENSMUSE00000562992 Chr15:25673931..25674011 TGGCAACACTAAGCTCCTCA Chr15:25673950..25673969 59.59 50
upstream ENSMUSE00000624376 Chr15:25682665..25683075 TCAATGGCACCTATGGTCAA Chr15:25682813..25682832 59.92 45
upstream ENSMUSE00000684000 Chr15:25682743..25683075 TCAATGGCACCTATGGTCAA Chr15:25682813..25682832 59.92 45

*** Putative Vector Insertion (Chr 15: 25683076 - 25705775) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562961 Chr15:25705776..25705900 ATACCCTGCTTTCCGAATCC Chr15:25705868..25705887 60.29 50
downstream ENSMUSE00000562960 Chr15:25706073..25706187 TCATAGACCTGCAGGAGCAC Chr15:25706153..25706172 58.99 55
downstream ENSMUSE00000649963 Chr15:25707836..25707942 GCACGGTCAATCTCCTCTTC Chr15:25707903..25707922 59.81 55
downstream ENSMUSE00000649961 Chr15:25709338..25709565 ACCACACCACAGAGGACCTT Chr15:25709373..25709392 59.45 55
downstream ENSMUSE00000649959 Chr15:25710119..25710167 GGAGGTCAGCTTCTCTTTGC Chr15:25710156..25710175 59.17 55
downstream ENSMUSE00000649957 Chr15:25710729..25711619 TCCTCGTAATCGTCCTGGTC Chr15:25711483..25711502 60.07 55
downstream ENSMUSE00000649953 Chr15:25712673..25712796 AGTCTCGCCGGTAGGAAAGT Chr15:25712745..25712764 60.27 55
downstream ENSMUSE00000649950 Chr15:25715558..25715801 CTCGTCCTTCAGGACACACC Chr15:25715610..25715629 60.71 60
downstream ENSMUSE00000649948 Chr15:25722906..25723001 GATGATGTCGATCCCGTTCT Chr15:25722954..25722973 59.89 50
downstream ENSMUSE00000649946 Chr15:25725438..25725531 GTCTGTGGACGAGTGGACCT Chr15:25725483..25725502 60.16 60
downstream ENSMUSE00000649943 Chr15:25726954..25727009 CAGAGGCGCATACAGAATCA Chr15:25726999..25727018 59.97 50
downstream ENSMUSE00000649940 Chr15:25729166..25729308 CAGCAGGGTTATCCAGTGGT Chr15:25729259..25729278 59.99 55
downstream ENSMUSE00000649936 Chr15:25729796..25729990 AGGGAGGACATCTTCGGACT Chr15:25729844..25729863 60.07 55
downstream ENSMUSE00000649933 Chr15:25730878..25731035 CCATACACGGTGACATTCCA Chr15:25730905..25730924 60.24 50
downstream ENSMUSE00000649931 Chr15:25733018..25733141 CTCCACCACGTCAGAGTTGA Chr15:25733050..25733069 59.86 55
downstream ENSMUSE00000649929 Chr15:25734054..25734351 GGCACCTTGTTGGTCTGTTT Chr15:25734243..25734262 60.01 50
downstream ENSMUSE00000649927 Chr15:25735266..25735473 CTTCTCCATCTCGGTTCCTG Chr15:25735305..25735324 59.8 55
downstream ENSMUSE00000649925 Chr15:25736298..25736434 CCACCTGTCCGTTGTACTCA Chr15:25736382..25736401 59.59 55
downstream ENSMUSE00000649922 Chr15:25736812..25736932 GCAAACTCCACGCTGTCTTT Chr15:25736919..25736938 60.44 50
downstream ENSMUSE00000649920 Chr15:25737491..25737943 TGATCCATAACCAGGCCACT Chr15:25737928..25737947 60.34 50
downstream ENSMUSE00000649919 Chr15:25740114..25740305 CCGCTCGTCAACTACGATCT Chr15:25740284..25740303 60.42 55
downstream ENSMUSE00000404800 Chr15:25741876..25743426 TTGTGAGCAGACTCGTTTGG Chr15:25743335..25743354 60.03 50
downstream ENSMUSE00000562965 Chr15:25741876..25741980 CACAGAGCGTGTGGTGCTAT Chr15:25741956..25741975 59.93 55
downstream ENSMUSE00000684019 Chr15:25741876..25743428 TTGTGAGCAGACTCGTTTGG Chr15:25743335..25743354 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTTGGCTCCTTTCTCCTT Chr15:25689088..25689108 59.6 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAACTCGTGACTGGGAAA Chr15:25689120..25689140 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022272