Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15074
Trapped Gene
Kif5b (ENSMUSG00000006740)
Vector Insertion
Chr 18: 6227585 - 6234901
Public Clones D111G06 (ggtc) PST970-2 (escells) PST13715-NL (escells) PST5971-NR (escells)
IST11186F9 (tigm) IST15063G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000140110 (Chr18:6234813..6234900 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000140110 (Chr18:6234813..6234900 -)
Downstram Exon
ENSMUSE00000140125 (Chr18:6227586..6227659 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000354579 Chr18:6240980..6241498 No primer for this exon
upstream ENSMUSE00000140110 Chr18:6234813..6234900 No primer for this exon
upstream ENSMUSE00000140125 Chr18:6227586..6227659 No primer for this exon

*** Putative Vector Insertion (Chr 18: 6227585 - 6234901) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000140122 Chr18:6226862..6226966 No primer for this exon
downstream ENSMUSE00000140107 Chr18:6226380..6226428 No primer for this exon
downstream ENSMUSE00000140133 Chr18:6225766..6225821 No primer for this exon
downstream ENSMUSE00000140142 Chr18:6225595..6225682 No primer for this exon
downstream ENSMUSE00000140127 Chr18:6225316..6225440 No primer for this exon
downstream ENSMUSE00000140113 Chr18:6223969..6224073 No primer for this exon
downstream ENSMUSE00000140135 Chr18:6223544..6223689 No primer for this exon
downstream ENSMUSE00000140139 Chr18:6222717..6222865 No primer for this exon
downstream ENSMUSE00000301852 Chr18:6220800..6220993 No primer for this exon
downstream ENSMUSE00000140119 Chr18:6220222..6220290 No primer for this exon
downstream ENSMUSE00000140130 Chr18:6216739..6216945 No primer for this exon
downstream ENSMUSE00000301774 Chr18:6216221..6216364 No primer for this exon
downstream ENSMUSE00000301743 Chr18:6214510..6214698 No primer for this exon
downstream ENSMUSE00000140108 Chr18:6213968..6214085 No primer for this exon
downstream ENSMUSE00000301688 Chr18:6213391..6213452 No primer for this exon
downstream ENSMUSE00000301652 Chr18:6213185..6213294 No primer for this exon
downstream ENSMUSE00000301633 Chr18:6212515..6212616 No primer for this exon
downstream ENSMUSE00000301609 Chr18:6211190..6211250 No primer for this exon
downstream ENSMUSE00000140134 Chr18:6211022..6211093 No primer for this exon
downstream ENSMUSE00000140137 Chr18:6210698..6210802 No primer for this exon
downstream ENSMUSE00000140109 Chr18:6208998..6209214 No primer for this exon
downstream ENSMUSE00000301548 Chr18:6208185..6208333 No primer for this exon
downstream ENSMUSE00000346985 Chr18:6202233..6203705 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGATGCCTTAATCGCCTTG Chr18:6234839..6234860 61.29 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATCTCTTACGTGACTGGGAAAA Chr18:6234836..6234859 59.19 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006740