Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15088
Trapped Gene
Rps10 (ENSMUSG00000052146)
Vector Insertion
Chr 17: 27769223 - 27771189
Public Clones CMHD-GT_409D11-3 (cmhd) PST3221-NL (escells) PST13269-NL (escells) PST8778-NL (escells)
PST13563-NL (escells) PST171-2 (escells) PST2063-NR (escells) PST13350-NL (escells)
PST1628-1 (escells)
Private Clones not available
Severity of mutation (?) Insertion after 65% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139792 (Chr17:27771017..27771188 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGAGACTACCTGCACCT Chr17:27771085..27771104 59.47 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139792 (Chr17:27771017..27771188 -)
Downstram Exon
ENSMUSE00000139788 (Chr17:27769224..27769301 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGAGACTACCTGCACCT Chr17:27771085..27771104 59.47 60 GCGCTCCTTCTGTAGGTGTC Chr17:27769210..27769229 60.02 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700896 Chr17:27773510..27773574 CAGTCCCCCATCAGACAACT Chr17:27773521..27773540 59.96 55
upstream ENSMUSE00000700904 Chr17:27772149..27772221 No primer for this exon
upstream ENSMUSE00000700926 Chr17:27772149..27772185 No primer for this exon
upstream ENSMUSE00000549878 Chr17:27771271..27771420 CGGATTGCCATCTACGAACT Chr17:27771380..27771399 60.1 50
upstream ENSMUSE00000721935 Chr17:27771271..27771420 CGGATTGCCATCTACGAACT Chr17:27771380..27771399 60.1 50
upstream ENSMUSE00000139792 Chr17:27771017..27771188 CTCCGAGACTACCTGCACCT Chr17:27771085..27771104 59.47 60
upstream ENSMUSE00000139788 Chr17:27769224..27769301 ACCTACAGAAGGAGCGCTGT Chr17:27769229..27769248 59.12 55

*** Putative Vector Insertion (Chr 17: 27769223 - 27771189) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700902 Chr17:27768145..27768200 GCCTCAGCTTTCTTGTCAGC Chr17:27768154..27768173 60.28 55
downstream ENSMUSE00000139784 Chr17:27767374..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50
downstream ENSMUSE00000700895 Chr17:27767369..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50
downstream ENSMUSE00000700898 Chr17:27767367..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTCGAGGCTACGTGAAGG Chr17:27771159..27771179 60.01 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCTCGAGGCTACGTGAAGG Chr17:27771159..27771179 60.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGGCCCAAAGGTACTGATTC Chr17:27771005..27771025 61.75 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGGCCCAAAGGTACTGATTC Chr17:27771005..27771025 61.75 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052146