Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15120
Trapped Gene
Epha2 (ENSMUSG00000006445)
Vector Insertion
Chr 4: 140878040 - 140878117
Public Clones PST12595-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000350172 (Chr4:140877978..140878039 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000350172 (Chr4:140877978..140878039 +)
Downstram Exon
ENSMUSE00000309345 (Chr4:140878118..140878327 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000309437 Chr4:140857155..140857349 No primer for this exon
upstream ENSMUSE00000309430 Chr4:140862429..140862496 No primer for this exon
upstream ENSMUSE00000309419 Chr4:140864320..140864995 No primer for this exon
upstream ENSMUSE00000309411 Chr4:140872502..140872657 No primer for this exon
upstream ENSMUSE00000309404 Chr4:140872786..140873118 No primer for this exon
upstream ENSMUSE00000309398 Chr4:140874397..140874512 No primer for this exon
upstream ENSMUSE00000309394 Chr4:140874838..140874991 No primer for this exon
upstream ENSMUSE00000309389 Chr4:140876409..140876508 No primer for this exon
upstream ENSMUSE00000309380 Chr4:140877132..140877187 No primer for this exon
upstream ENSMUSE00000309369 Chr4:140877380..140877505 No primer for this exon
upstream ENSMUSE00000381679 Chr4:140877617..140877805 No primer for this exon
upstream ENSMUSE00000350172 Chr4:140877978..140878039 No primer for this exon

*** Putative Vector Insertion (Chr 4: 140878040 - 140878117) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000309345 Chr4:140878118..140878327 No primer for this exon
downstream ENSMUSE00000524376 Chr4:140878501..140878650 No primer for this exon
downstream ENSMUSE00000183465 Chr4:140879328..140879521 No primer for this exon
downstream ENSMUSE00000309324 Chr4:140880147..140880302 No primer for this exon
downstream ENSMUSE00000360227 Chr4:140884328..140885293 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGGTAAGGTCATGCTCTGC Chr4:140878038..140878058 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCGCTAGACAAGTTCCTT Chr4:140878017..140878038 60.03 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006445