Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15132
Trapped Gene
Paics (ENSMUSG00000029247)
Vector Insertion
Chr 5: 77380861 - 77383979
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) E087A09 (ggtc)
D185D03 (ggtc) (ggtc) E087A09 (ggtc) D143F09 (ggtc) E001E06 (ggtc)
(ggtc) D030C04 (ggtc) (cmhd) PST945-2 (escells) PST516-1 (escells)
PST9021-NR (escells) PST1491-1 (escells) PST6562-NR (escells) PST1520-1 (escells)
PSTVU01.HL7 (vanderbilt) IST10609D6 (tigm) IST10017E7 (tigm) IST14780H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408986 (Chr5:77380830..77380860 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408986 (Chr5:77380830..77380860 +)
Downstram Exon
ENSMUSE00000695715 (Chr5:77383980..77383989 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000722120 Chr5:77380373..77380693 GTGGGAGGCTCCGTTATTTT Chr5:77380393..77380412 60.32 50
upstream ENSMUSE00000712346 Chr5:77380393..77380426 GTGGGAGGCTCCGTTATTTT Chr5:77380393..77380412 60.32 50
upstream ENSMUSE00000710719 Chr5:77380794..77380860 GCGGTCTGCTCCTCTAGTTC Chr5:77380815..77380834 59.19 60
upstream ENSMUSE00000408986 Chr5:77380830..77380860 No primer for this exon

*** Putative Vector Insertion (Chr 5: 77380861 - 77383979) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695715 Chr5:77383980..77383989 No primer for this exon
downstream ENSMUSE00000349614 Chr5:77385568..77385768 CGTAGAGCTTCTTCCCGATG Chr5:77385600..77385619 59.97 55
downstream ENSMUSE00000485689 Chr5:77385571..77385768 CGTAGAGCTTCTTCCCGATG Chr5:77385600..77385619 59.97 55
downstream ENSMUSE00000234501 Chr5:77388340..77388518 CTGTACCCCAGGGTTCCTTT Chr5:77388476..77388495 60.22 55
downstream ENSMUSE00000187310 Chr5:77390135..77390314 CAAGGCCAGCAAAACAGAAT Chr5:77390210..77390229 60.25 45
downstream ENSMUSE00000187314 Chr5:77390418..77390531 ATGGCCATAGTCTCCAGGAA Chr5:77390502..77390521 59.51 50
downstream ENSMUSE00000187313 Chr5:77391452..77391535 GGTCTGCAACCCACTCAAAG Chr5:77391530..77391549 60.69 55
downstream ENSMUSE00000187309 Chr5:77393467..77393647 GGTCCTTTATGCGCAGATGT Chr5:77393615..77393634 60.1 50
downstream ENSMUSE00000187315 Chr5:77395272..77395430 CACTGGGCAGTCGAAGAGAT Chr5:77395433..77395452 60.41 55
downstream ENSMUSE00000390527 Chr5:77395673..77396528 CAAATTCAGGTCGTCTGCAA Chr5:77396296..77396315 59.84 45
downstream ENSMUSE00000709158 Chr5:77395673..77396338 CAAATTCAGGTCGTCTGCAA Chr5:77396296..77396315 59.84 45
downstream ENSMUSE00000710468 Chr5:77395673..77396534 CAAATTCAGGTCGTCTGCAA Chr5:77396296..77396315 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGATAATCGCCTTGCAGCAC Chr5:77380909..77380929 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCGGTCTGCTCCTCTAGTTC Chr5:77383816..77383836 59.19 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029247