Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15133
Trapped Gene
Larp5 (ENSMUSG00000033499)
Vector Insertion
Chr 13: 9093427 - 9121353
Public Clones (sanger) PST12365-NR (escells) IST13455D1 (tigm) IST14573G6 (tigm)
IST14346B5 (tigm) IST11186F9 (tigm)
Private Clones OST237899 (lexicon) OST165962 (lexicon) OST151740 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000684821 (Chr13:9093151..9093426 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGAGGTTGAGACATTTTCG Chr13:9093202..9093222 59.86 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000684821 (Chr13:9093151..9093426 +)
Downstram Exon
ENSMUSE00000572077 (Chr13:9121354..9121472 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGAGGTTGAGACATTTTCG Chr13:9093202..9093222 59.86 47.62 GCCACAACTTTAGCGTCCTG Chr13:9121426..9121445 60.83 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684821 Chr13:9093151..9093426 CTCGAGGTTGAGACATTTTCG Chr13:9093202..9093222 59.86 47.62

*** Putative Vector Insertion (Chr 13: 9093427 - 9121353) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000572077 Chr13:9121354..9121472 GCCACAACTTTAGCGTCCTG Chr13:9121426..9121445 60.83 55
downstream ENSMUSE00000643976 Chr13:9123149..9123208 TGGTTTGCGATATAGGACCA Chr13:9123176..9123195 58.99 45
downstream ENSMUSE00000643972 Chr13:9136025..9136172 TCCCCCATACCTTTGCATTA Chr13:9136079..9136098 60.15 45
downstream ENSMUSE00000643968 Chr13:9136401..9136547 ACCATTGGCATCCAATCCTA Chr13:9136426..9136445 60.15 45
downstream ENSMUSE00000643964 Chr13:9143000..9143078 GTACTTCCCGAGGGTCTTCC Chr13:9143050..9143069 59.94 60
downstream ENSMUSE00000643960 Chr13:9144628..9144764 TGTCGCTAGCAAGATTCTCC Chr13:9144650..9144669 58.2 50
downstream ENSMUSE00000643959 Chr13:9146647..9146750 TATGCACCGGTTCTGATTTG Chr13:9146714..9146733 59.54 45
downstream ENSMUSE00000252145 Chr13:9149072..9149182 TGCTGTGCATCAGCTTCTGT Chr13:9149184..9149203 60.78 50
downstream ENSMUSE00000252139 Chr13:9150111..9150164 No primer for this exon
downstream ENSMUSE00000252132 Chr13:9150261..9150470 GTGTTGTTGACCACGTCTGG Chr13:9150450..9150469 60.05 55
downstream ENSMUSE00000252125 Chr13:9157369..9157475 GACGTTGCAGGTTTGAAGGT Chr13:9157439..9157458 60.16 50
downstream ENSMUSE00000252119 Chr13:9157797..9158048 CATGGCGCAGATGAGACTTA Chr13:9157828..9157847 59.97 50
downstream ENSMUSE00000252111 Chr13:9163921..9163966 TTTCTTCCGATAGCCAAAGG Chr13:9163951..9163970 59.29 45
downstream ENSMUSE00000252103 Chr13:9165563..9165727 AGTTGGACAGTCCCAGTTCG Chr13:9165635..9165654 60.15 55
downstream ENSMUSE00000252095 Chr13:9167924..9168048 CTCTGGGTCCCACTACAGGA Chr13:9167978..9167997 60.1 60
downstream ENSMUSE00000252088 Chr13:9168144..9168252 TTCACCTGCACGGATTTACA Chr13:9168242..9168261 60.11 45
downstream ENSMUSE00000410939 Chr13:9169898..9172332 CTGCTGGACACCCTACCAAT Chr13:9170619..9170638 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCGGTTTCGGGTACATTA Chr13:9096442..9096462 58.89 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGTCGTGACTGGGAAAAC Chr13:9096473..9096493 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033499