Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15135
Trapped Gene
Ehmt2 (ENSMUSG00000013787)
Vector Insertion
Chr 17: 35042657 - 35042854
Public Clones PST9425-NR (escells) PST10801-NL (escells) PST10232-NR (escells) PST12338-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000141510 (Chr17:35042555..35042656 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000141510 (Chr17:35042555..35042656 +)
Downstram Exon
ENSMUSE00000284767 (Chr17:35042855..35043003 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000464580 Chr17:35035444..35035485 No primer for this exon
upstream ENSMUSE00000608074 Chr17:35035919..35036198 No primer for this exon
upstream ENSMUSE00000486447 Chr17:35036132..35036198 No primer for this exon
upstream ENSMUSE00000336190 Chr17:35036305..35036511 No primer for this exon
upstream ENSMUSE00000284974 Chr17:35036605..35036861 No primer for this exon
upstream ENSMUSE00000360678 Chr17:35039959..35040040 No primer for this exon
upstream ENSMUSE00000284903 Chr17:35040127..35040164 No primer for this exon
upstream ENSMUSE00000366225 Chr17:35040268..35040423 No primer for this exon
upstream ENSMUSE00000405553 Chr17:35042074..35042211 No primer for this exon
upstream ENSMUSE00000284818 Chr17:35042287..35042401 No primer for this exon
upstream ENSMUSE00000141510 Chr17:35042555..35042656 No primer for this exon

*** Putative Vector Insertion (Chr 17: 35042657 - 35042854) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000284767 Chr17:35042855..35043003 No primer for this exon
downstream ENSMUSE00000284746 Chr17:35043096..35043239 No primer for this exon
downstream ENSMUSE00000284718 Chr17:35043322..35043557 No primer for this exon
downstream ENSMUSE00000141503 Chr17:35043640..35043822 No primer for this exon
downstream ENSMUSE00000697819 Chr17:35043898..35044010 No primer for this exon
downstream ENSMUSE00000141522 Chr17:35043928..35044010 No primer for this exon
downstream ENSMUSE00000141514 Chr17:35044276..35044382 No primer for this exon
downstream ENSMUSE00000141523 Chr17:35044467..35044589 No primer for this exon
downstream ENSMUSE00000141506 Chr17:35044688..35044789 No primer for this exon
downstream ENSMUSE00000141505 Chr17:35045119..35045223 No primer for this exon
downstream ENSMUSE00000141518 Chr17:35045349..35045503 No primer for this exon
downstream ENSMUSE00000141520 Chr17:35045583..35045750 No primer for this exon
downstream ENSMUSE00000545097 Chr17:35047636..35047780 No primer for this exon
downstream ENSMUSE00000141509 Chr17:35047923..35048000 No primer for this exon
downstream ENSMUSE00000141498 Chr17:35048308..35048423 No primer for this exon
downstream ENSMUSE00000141502 Chr17:35048524..35048610 No primer for this exon
downstream ENSMUSE00000141507 Chr17:35049334..35049412 No primer for this exon
downstream ENSMUSE00000545083 Chr17:35049579..35049754 No primer for this exon
downstream ENSMUSE00000608073 Chr17:35050585..35050990 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:35042707..35042727 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATGCGTGACTGGGAAAAC Chr17:35042703..35042723 63.75 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013787