Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15165
Trapped Gene
Zkscan1 (ENSMUSG00000029729)
Vector Insertion
Chr 5: 138526460 - 138534147
Public Clones (sanger) (sanger) (sanger) D036C06 (ggtc) D036C06 (ggtc) PST11835-NL (escells)
IST14280C12 (tigm) IST14781D6 (tigm) IST14157E10 (tigm) IST14413A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000372291 (Chr5:138526312..138526459 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTATTGGGAGGGCCTATGT Chr5:138526353..138526372 60.04 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000372291 (Chr5:138526312..138526459 +)
Downstram Exon
ENSMUSE00000192121 (Chr5:138534148..138534660 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTATTGGGAGGGCCTATGT Chr5:138526353..138526372 60.04 55 GGTAACAGAAGCGCCTGAAC Chr5:138534430..138534449 59.88 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000372291 Chr5:138526312..138526459 GGTATTGGGAGGGCCTATGT Chr5:138526353..138526372 60.04 55
upstream ENSMUSE00000686037 Chr5:138526348..138526459 GGTATTGGGAGGGCCTATGT Chr5:138526353..138526372 60.04 55

*** Putative Vector Insertion (Chr 5: 138526460 - 138534147) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000686033 Chr5:138533868..138534660 GGCCCAAAAGTGTTCTGGTA Chr5:138534446..138534465 59.97 50
downstream ENSMUSE00000192121 Chr5:138534148..138534660 GGTAACAGAAGCGCCTGAAC Chr5:138534430..138534449 59.88 55
downstream ENSMUSE00000718095 Chr5:138534148..138534660 GGTAACAGAAGCGCCTGAAC Chr5:138534430..138534449 59.88 55
downstream ENSMUSE00000457488 Chr5:138534154..138534660 GGTAACAGAAGCGCCTGAAC Chr5:138534430..138534449 59.88 55
downstream ENSMUSE00000192129 Chr5:138535220..138535367 GGCAGTTTCATGATGGTCAA Chr5:138535321..138535340 59.5 45
downstream ENSMUSE00000192117 Chr5:138538295..138538386 GGGAATCTGCGGTCAATAGT Chr5:138538387..138538406 59.01 50
downstream ENSMUSE00000192116 Chr5:138538681..138538807 TTCTGACATCCCCATTCCTC Chr5:138538745..138538764 59.86 50
downstream ENSMUSE00000487886 Chr5:138541818..138549050 CTGCTGTTCCCGTTTCTCTC Chr5:138541942..138541961 59.99 55
downstream ENSMUSE00000686032 Chr5:138541818..138545719 CTGCTGTTCCCGTTTCTCTC Chr5:138541942..138541961 59.99 55
downstream ENSMUSE00000686035 Chr5:138541818..138545720 CTGCTGTTCCCGTTTCTCTC Chr5:138541942..138541961 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr5:138532511..138532531 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGAGCGTGACTGGGAAAA Chr5:138532505..138532525 63.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029729