Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15167
Trapped Gene
Zfp185 (ENSMUSG00000031351)
Vector Insertion
Chr X: 70248799 - 70257778
Public Clones PST11827-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274276 (ChrX:70248712..70248798 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274276 (ChrX:70248712..70248798 +)
Downstram Exon
ENSMUSE00000274267 (ChrX:70257779..70257967 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CATCTTGTAGGGTGCCAGGT ChrX:70257855..70257874 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699738 ChrX:70232721..70232858 No primer for this exon
upstream ENSMUSE00000708297 ChrX:70242374..70242451 No primer for this exon
upstream ENSMUSE00000720960 ChrX:70242374..70242451 No primer for this exon
upstream ENSMUSE00000699714 ChrX:70242621..70242744 ACCAGAGCTGGATCACCAAG ChrX:70242699..70242718 60.26 55
upstream ENSMUSE00000699736 ChrX:70242621..70242744 ACCAGAGCTGGATCACCAAG ChrX:70242699..70242718 60.26 55
upstream ENSMUSE00000699712 ChrX:70243077..70243142 GAGCCACTCTCACGTCACAA ChrX:70243078..70243097 60.03 55
upstream ENSMUSE00000699735 ChrX:70243077..70243142 GAGCCACTCTCACGTCACAA ChrX:70243078..70243097 60.03 55
upstream ENSMUSE00000699704 ChrX:70243121..70243142 No primer for this exon
upstream ENSMUSE00000699711 ChrX:70243875..70243913 GGGCTCCAGCTGGTTACATA ChrX:70243889..70243908 60.1 55
upstream ENSMUSE00000699734 ChrX:70243875..70243913 GGGCTCCAGCTGGTTACATA ChrX:70243889..70243908 60.1 55
upstream ENSMUSE00000699710 ChrX:70244008..70244085 ATCGCCCCTCTAAGACCAAC ChrX:70244052..70244071 60.46 55
upstream ENSMUSE00000699732 ChrX:70244008..70244085 ATCGCCCCTCTAAGACCAAC ChrX:70244052..70244071 60.46 55
upstream ENSMUSE00000655386 ChrX:70244590..70244676 CTGGGAGCAGCTAATTCTGG ChrX:70244603..70244622 59.97 55
upstream ENSMUSE00000699731 ChrX:70244590..70244676 CTGGGAGCAGCTAATTCTGG ChrX:70244603..70244622 59.97 55
upstream ENSMUSE00000715521 ChrX:70244590..70244676 CTGGGAGCAGCTAATTCTGG ChrX:70244603..70244622 59.97 55
upstream ENSMUSE00000208571 ChrX:70245356..70245439 GAAGAGGAGGTGCCATTCAC ChrX:70245399..70245418 59.66 55
upstream ENSMUSE00000274297 ChrX:70246327..70246410 CTGCACTTGGTGTTCTGAGG ChrX:70246335..70246354 59.46 55
upstream ENSMUSE00000208566 ChrX:70246744..70246785 No primer for this exon
upstream ENSMUSE00000699730 ChrX:70246747..70246785 No primer for this exon
upstream ENSMUSE00000208560 ChrX:70247914..70247997 CTGCTCTGGCAAGACCTGAT ChrX:70247964..70247983 60.56 55
upstream ENSMUSE00000274276 ChrX:70248712..70248798 No primer for this exon

*** Putative Vector Insertion (Chr X: 70248799 - 70257778) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274267 ChrX:70257779..70257967 CATCTTGTAGGGTGCCAGGT ChrX:70257855..70257874 59.99 55
downstream ENSMUSE00000208574 ChrX:70261078..70261188 TGCTTGAGACACCAGGAACA ChrX:70261169..70261188 60.44 50
downstream ENSMUSE00000208587 ChrX:70262034..70262114 TGGCTTCCCAGAAGACACTT ChrX:70262097..70262116 59.84 50
downstream ENSMUSE00000208563 ChrX:70263713..70263781 TACCTTCATGTGGGGCTTTC ChrX:70263771..70263790 59.93 50
downstream ENSMUSE00000208562 ChrX:70266207..70266309 GCAGATGCCAAGATGTTCAA ChrX:70266291..70266310 59.81 45
downstream ENSMUSE00000208585 ChrX:70274184..70274282 GGAGATCACCCATCGGTTTA ChrX:70274220..70274239 59.75 50
downstream ENSMUSE00000699703 ChrX:70275012..70276882 CCAGGGATCGTCAACAGTTT ChrX:70275377..70275396 59.97 50
downstream ENSMUSE00000699719 ChrX:70275012..70276852 CCAGGGATCGTCAACAGTTT ChrX:70275377..70275396 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACACACGATAATCGCCTTGC ChrX:70251842..70251862 61.06 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAGCCCTGAGGTACTGA ChrX:70257787..70257807 60.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031351