Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15168
Trapped Gene
Hnrph1 (ENSMUSG00000007850)
Vector Insertion
Chr 11: 50196374 - 50196429
Public Clones PST11204-NR (escells) PST11816-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000103883 (Chr11:50196302..50196373 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000103883 (Chr11:50196302..50196373 +)
Downstram Exon
ENSMUSE00000103887 (Chr11:50196430..50196563 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679162 Chr11:50190492..50190649 No primer for this exon
upstream ENSMUSE00000679161 Chr11:50190816..50190942 No primer for this exon
upstream ENSMUSE00000103891 Chr11:50191286..50191304 No primer for this exon
upstream ENSMUSE00000103889 Chr11:50191793..50191929 No primer for this exon
upstream ENSMUSE00000721161 Chr11:50191793..50191929 No primer for this exon
upstream ENSMUSE00000103875 Chr11:50192970..50193125 No primer for this exon
upstream ENSMUSE00000103873 Chr11:50193323..50193466 No primer for this exon
upstream ENSMUSE00000479443 Chr11:50194961..50195099 No primer for this exon
upstream ENSMUSE00000103885 Chr11:50196039..50196217 No primer for this exon
upstream ENSMUSE00000103883 Chr11:50196302..50196373 No primer for this exon

*** Putative Vector Insertion (Chr 11: 50196374 - 50196429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000103887 Chr11:50196430..50196563 No primer for this exon
downstream ENSMUSE00000513096 Chr11:50196681..50196816 No primer for this exon
downstream ENSMUSE00000496715 Chr11:50197182..50197241 No primer for this exon
downstream ENSMUSE00000103884 Chr11:50197333..50197422 No primer for this exon
downstream ENSMUSE00000471098 Chr11:50198146..50198238 No primer for this exon
downstream ENSMUSE00000103893 Chr11:50198643..50198692 No primer for this exon
downstream ENSMUSE00000580013 Chr11:50199279..50200029 No primer for this exon
downstream ENSMUSE00000679160 Chr11:50199279..50200030 No primer for this exon
downstream ENSMUSE00000679163 Chr11:50199279..50200029 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGGCTATGGATTTGGTTC Chr11:50196337..50196358 59.78 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATGGCTATGGATTTGGTTC Chr11:50196337..50196358 59.78 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007850