Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15171
Trapped Gene
Dppa4 (ENSMUSG00000058550)
Vector Insertion
Chr 16: 48293094 - 48293094
Public Clones PST11776-NR (escells) PST10485-NR (escells) PST6307-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000699695 (Chr16:48293024..48293093 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAAATGTGGTGTGTGGTT Chr16:48293024..48293043 60.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000699695 (Chr16:48293024..48293093 +)
Downstram Exon
ENSMUSE00000699694 (Chr16:48293095..48293219 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAAATGTGGTGTGTGGTT Chr16:48293024..48293043 60.53 50 CATGTTGTCCTCCAGGTGTG Chr16:48293199..48293218 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000129201 Chr16:48283848..48283954 GTCTTTTGGAAGCTGGGAGA Chr16:48283879..48283898 59.4 50
upstream ENSMUSE00000707235 Chr16:48283931..48283954 TGGAGACTGCTGGAGACAAG Chr16:48283932..48283951 59.12 55
upstream ENSMUSE00000488822 Chr16:48287991..48288108 CAGAAGAGCCGAAGGAAGAA Chr16:48287998..48288017 59.69 50
upstream ENSMUSE00000129203 Chr16:48289152..48289318 GCCAGAAGAAACGAGTGAGC Chr16:48289287..48289306 60.14 55
upstream ENSMUSE00000618529 Chr16:48289152..48289213 ACGCCAGGACAGACTCGTAG Chr16:48289190..48289209 60.47 60
upstream ENSMUSE00000129208 Chr16:48289441..48289491 AGGGCTTTCCCAGAACAAAT Chr16:48289471..48289490 59.94 45
upstream ENSMUSE00000331497 Chr16:48291127..48291427 TTGAGGAACGTCCCTGACTC Chr16:48291133..48291152 60.24 55
upstream ENSMUSE00000351172 Chr16:48291127..48291428 TTGAGGAACGTCCCTGACTC Chr16:48291133..48291152 60.24 55
upstream ENSMUSE00000336136 Chr16:48293024..48293219 AAGCCTGGGTACCCGATAAG Chr16:48293105..48293124 60.33 55
upstream ENSMUSE00000699695 Chr16:48293024..48293093 GGGAAATGTGGTGTGTGGTT Chr16:48293024..48293043 60.53 50

*** Putative Vector Insertion (Chr 16: 48293094 - 48293094) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000699694 Chr16:48293095..48293219 CATGTTGTCCTCCAGGTGTG Chr16:48293199..48293218 60 55
downstream ENSMUSE00000618530 Chr16:48293812..48294405 CATGCGGAGGCTACAGGTAT Chr16:48294265..48294284 60.12 55
downstream ENSMUSE00000707234 Chr16:48293812..48293845 TCCTTCGAGGCTCTTAGTCAA Chr16:48293844..48293864 59.21 47.62

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr16:48293095..48293115 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000058550