Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI15185
Trapped Gene
Dnaja1 (ENSMUSG00000028410)
Vector Insertion
Chr 4: 40673243 - 40674988
Public Clones E324D09 (ggtc) E324D09 (ggtc) PST4571-NR (escells) PST11217-NR (escells)
PST2315-NR (escells) PST11493-NR (escells) PST10829-NR (escells) PST5582-NL (escells)
PST9639-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479344 (Chr4:40673138..40673242 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGTGCAACAAGAAAACTGG Chr4:40673187..40673206 59.73 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479344 (Chr4:40673138..40673242 +)
Downstram Exon
ENSMUSE00000496461 (Chr4:40674989..40675216 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGTGCAACAAGAAAACTGG Chr4:40673187..40673206 59.73 45 TGAACCATTCCTGGTCCAAT Chr4:40675088..40675107 60.17 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000178927 Chr4:40669566..40669666 No primer for this exon
upstream ENSMUSE00000297668 Chr4:40670736..40670877 CCACCCAGGAAGAATTGAAA Chr4:40670795..40670814 59.9 45
upstream ENSMUSE00000178918 Chr4:40671006..40671183 TGTTCTTTGGAGGAGGAGGA Chr4:40671142..40671161 59.77 50
upstream ENSMUSE00000479344 Chr4:40673138..40673242 TGGTGCAACAAGAAAACTGG Chr4:40673187..40673206 59.73 45

*** Putative Vector Insertion (Chr 4: 40673243 - 40674988) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496461 Chr4:40674989..40675216 TGAACCATTCCTGGTCCAAT Chr4:40675088..40675107 60.17 45
downstream ENSMUSE00000493612 Chr4:40677206..40677320 CTCCTTCACCGTGGAATGTT Chr4:40677250..40677269 59.97 50
downstream ENSMUSE00000178919 Chr4:40678717..40678832 No primer for this exon
downstream ENSMUSE00000495417 Chr4:40679109..40679209 TATGGCCGACGGTATATTGG Chr4:40679181..40679200 60.55 50
downstream ENSMUSE00000178924 Chr4:40679761..40680932 GCAGAAGGGGATGCAATCTA Chr4:40680563..40680582 60.18 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGATTAATCGCCTTGCAG Chr4:40673288..40673308 59.81 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTGTTGTTAGCTGGGTTG Chr4:40673263..40673283 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028410